E-ISSN: 2814 – 1822; P-ISSN: 2616 – 0668
ORIGINAL RESEARCH ARTICLE
Suraj Y. A.1, Sani, N. M.1, Mienda B. S.1, Mansur M. M.1and Mujahid, N. S.2
1Department of Microbiology and Biotechnology, Federal University Dutse, Jigawa State Nigeria
2Aliko Dangote University of Science and Technology, Wudil, Kano – Nigeria
Corresponding Author: surajoymainasara@gmail.com
The impacts of Helicobacter pylori affect almost 90% of the world's population which varies substantially between nations and within populations. A total of 302 patients were included in an analytical cross-sectional study. Patients between the ages of 18 and 83 were recruited between March 2020 and March 2021, and closed-ended questionnaires were used to gather data. Five milliliters of blood were drawn from individuals with dyspepsia and centrifuged at 3000 rpm for 5 minutes. A H. pylori test kit was used to perform a serological assay for IgG antibodies. Approximately 232 individuals (76.8% greatest prevalence by age group) in this study had dyspepsia; the prevalence was 31.8% in females (96 patients) and 68.2% in males (206 patients). The findings indicated a high prevalence of H. pylori in the studied area, with a higher rate in males compared to females. Among the participants, those aged 31-40 years had the highest prevalence at 31.5%, with an average age of 35.5 years. The prevalence differs significantly based on geographic location, age, and gender. Screening of younger dyspeptic patients should be prioritized to prevent further complications, and assessing the effectiveness of diagnostic tests in younger individuals is clinically significant. Additionally, raising public awareness about the causes, transmission modes, and risk factors of H. pylori infection in the region is essential.
KEYWORDS: Helicobacter pylori, seroprevalence, dyspepsia, seropositive and seronegative
Helicobacter pylori (H. pylori) is a spiral-shaped, Gram-negative bacterium that resides in the gastric mucous layer or adheres to the epithelial lining of the stomach (Ali &AlHussaini, 2024). This bacterium causes persistent infections that can lead to gastroduodenal complications, including peptic ulcer disease, gastric adenocarcinoma, and gastric mucosa-associated lymphoid tissue lymphoma (Reyes, 2023). It has been associated with acid peptic diseases of the stomach and duodenum, as well as stomach neoplasms (Retnakumar et al., 2022). The human stomach serves as the primary reservoir for H. pylori, which can potentially spread to the external environment through feces, vomit, or gastric regurgitation. H. pylori is recognized as the main cause of gastritis in humans and plays a crucial role in the development of peptic ulcers (Duan et al., 2023). Numerous studies conducted in Brazil and globally aim to better understand the disease's pathogenesis, assess its epidemiological and diagnostic aspects, reduce the incidence of H. pylori infections, and enhance patient outcomes. In Iran, the seroprevalence of H. pylori among the pediatric population exceeds 65% (Mladenova, 2021). The prevalence of H. pylori varies significantly across the globe, with developing countries experiencing rates as high as 90%, while industrialized nations report lower rates (Secka et al., 2013). For instance, in South America, Bangladesh, and Pakistan, the prevalence is around 80%, whereas it is 26% in Switzerland, 11% in Sweden, and between 20% and 50% in France (Parisi et al., 2020).
Epidemiological studies indicate that the prevalence of H. pylori infection increases with age and is more common in developing countries, including Nigeria, as well as among populations with low socioeconomic status (Leja et al., 2019). This is likely due to factors that facilitate the acquisition of the infection, such as poor hygiene, overcrowded living conditions, and lack of sanitation (Smith et al., 2022). The bacterium can survive in the acidic environment of the stomach, primarily due to its high urease activity, which converts urea in gastric juice into alkaline ammonia and carbon dioxide (Khedia et al., 2025). H. pylori infection is widespread globally, but its prevalence varies significantly across different countries and among various population groups within the same country (Zhu et al., 2025). The infection is typically acquired through the oral ingestion of the bacterium and is most often transmitted within families during early childhood (Kouitcheu et al., 2025). Other modes of transmission include person-to-person spread via vomit, saliva, or feces, and in developing countries, water may also serve as a key route of transmission (Swalehe, 2025).
Dyspepsia is characterized by chronic or recurrent pain or discomfort in the upper abdomen, along with sensations of fullness, feeling full earlier than usual when eating, and may also involve symptoms such as belching, bloating, nausea, and vomiting (Malone, 2024). It can also be described as a symptom complex involving epigastric pain or discomfort believed to originate from the upper gastrointestinal tract. This may include symptoms like heartburn, acid regurgitation, excessive belching, increased abdominal bloating, nausea, indigestion, or early satiety (Malone, 2024).
Epidemiological studies have shown that the prevalence of H. pylori infection increases with age and is more common in developing countries, such as Nigeria, as well as among populations with low socioeconomic status (Rafeey et al., 2013). The infection is widespread globally, affecting approximately 90% of the world’s population (Secka et al., 2013). In developed countries, 30% to 40% of people are infected with H. pylori, whereas in developing countries, the prevalence is higher, ranging from 70% to 90% (Saad et al., 2008). This higher prevalence is likely linked to factors that promote infection acquisition, such as poor hygiene, overcrowded living conditions, inadequate sanitation, contaminated drinking water, a poor diet, occupational exposure to dyspeptic patients, a family history of gastric diseases, and genetic predisposition. H. pylori infection can be transmitted through various routes, including person-to-person contact.
This study aimed to investigate the seroprevalence and molecular detection of H. pylori infection among dyspepsia patients at Dutse General Hospital in Jigawa State, Nigeria, taking into account sociodemographic factors, clinical data, interviews, and responses to the administered questionnaires.
The research was conducted at Dutse General Hospital in Jigawa State, Nigeriafrom March 2020 to March 2021. Jigawa State is located in the Northwestern part of Nigeria that lies between latitudes 11.00°N and 13.00°N, and longitudes 8.00°E and 10.00°E. Jigawa State is composed of 27 Local Government Areas and is bordered to the west by Kano and Katsina States, to the east by Bauchi State, and to the northeast by Yobe State. To the north, Jigawa shares an international border with the Zinder Region of the Republic of Niger, providing a unique opportunity for cross-border trade activities.
Figure 1: Map of Jigawa State showing Dutse Local Government
The estimated population of Jigawa State was 6,779,080, as reported by the National Bureau of Statistics in 2019 (Olumoh et al., 2025). In this research, a sample size of 302 was used. The study involved recruiting patients with suspected dyspepsia, whose ages ranged from 18 to 83.
All consenting adult patients aged 18 years and above and of both genders who presented to the hospital on the account of dyspepsia.
Patients below 18 years of age and those who do not give their consent
The sample size of the study was calculated using experimental formula introduced by Ndububa et al. (2001):
\[n = \frac{Z^{2}pqn}{{\ d}^{2}}\]
Where: z = score for 95% confidence interval = 1.96, p = prevalence, q = 1-p
d = tolerable error = 5%
A proportion (prevalence) of 73% was used in the study
Sample size (n) = (1.96)2 X (0.73) (1-0.73)/0.052
= 3.8416X0.73 X 0.27/0.0025
= 302
302 Sample size was used in this study
Source: (Ndububa et al., 2001).
Prior to the commencement of the research, ethical approval was obtained from the Ministry of Health, Jigawa State, Nigeria, through the Head of the Microbiology and Biotechnology Department at the Federal University Dutse, Jigawa State, Nigeria. Consent forms were completed and signed by the patients or their guardians for those admitted for the serologic diagnosis (Appendix I).
Approximately 5 mL of blood sample was aseptically collected from the patients and transferred into an EDTA container for processing. Each sample was centrifuged at 3000 rpm for 5 minutes to separate the plasma from the cellular components. The sera were then stored at -20°C. A serological assay for Immunoglobulin G antibodies against H. pylori was performed using a H. pylori Rapid Test Device with the serum from the collected blood specimens. The serum was separated as quickly as possible to prevent hemolysis, and only clear, non-hemolyzed specimens were used for testing.
The overall duration of this study was 12 months, from March 2020 to March 2021. The extended duration of the clinical tests was primarily due to the COVID-19 pandemic, which necessitated social distancing measures during the study period, resulting in delays in participant recruitment and data collection.
Helicobacter pylori infection was identified using a noninvasive serological test—the Bio-Save Rapid Diagnostic Test for H. pylori (intended for in vitro diagnostic use only; reagent manufactured in the United Kingdom) (Talebi, 2018). The test was chosen based on the clinical condition of each patient. The study included 302 participants, consisting of 206 males and 96 females, aged between 18 and 83 years.
Before testing, the test components, including the specimen, buffer, and/or controls, were allowed to reach room temperature (approximately 30°C). The sealed test pouch was stored at room temperature and opened only when ready for use. The test device was immediately removed and placed on a clean, level surface. For serum samples, two drops (approximately 50 µL) were dispensed into the specimen well using a vertical dropper, followed by one drop of buffer. The timing of the reaction was carefully monitored, and the appearance of colored lines was observed. Test results were interpreted at 10 minutes. The device contains H. pylori antigen-coated particles and anti-human IgG immobilized on the membrane.
H. pylori cultures were grown in nutrient broth under microaerophilic conditions at 37°C for 48 hours. Post-incubation, 1.5 mL of the culture was transferred to a microcentrifuge tube and centrifuged at 10,000 rpm for 5 minutes to pellet the bacterial cells. The supernatant was discarded, and the pellet was resuspended in 250 μL Buffer from a plasmid extraction kit. Cell lysis was performed by adding 250 μL of Lysis Buffer (containing SDS and NaOH), followed by gentle inversion of the tube 46 times and incubation at room temperature for 5 minutes. Lysis was neutralized by adding 350 μL of Neutralization Buffer, with gentle inversion until a white precipitate appeared. The sample was centrifuged at 12,000 rpm for 10 minutes, and the clear supernatant containing plasmid DNA was transferred to a silica-based spin column. The column was centrifuged at 12,000 rpm for 1 minute to bind the DNA, and then washed sequentially with 500 μL each of Washing Buffers 1 (W1) and 2 (W2), with centrifugation at 12,000 rpm for 1 minute after each wash. Plasmid DNA was eluted by adding 200 μL of Elution Buffer (nuclease-free water), incubating for 1 minute at room temperature, and centrifuging at 12,000 rpm for 1 minute. The purified DNA was stored at 4°C for subsequent analysis (Azami et al., 2024).
The cagA gene of H. pylori was amplified using specific primers and the AccuPowerHotStart PCR premix (Bioneer, Korea). The forward primer sequence was CTGCAAAAGATTGTTTGGCAGA, and the reverse primer sequence was CTGCAAAAGATTGTTTGGCAGA, with an expected amplicon size of 349 bp. The PCR reaction mixture was prepared in a total volume of 25 μL, containing 12.5 μL of the 2X PCR premix, 1 μL of each primer (10 μM concentration), 1 μg of the plasmid DNA template, and 10.5 μL of nuclease-free water (Xue et al., 2024).
The PCR amplification was carried out in a Thermal Cycler (PTC 100, MJ Research, USA) with the following cycling conditions: an initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 40 seconds. A final extension was performed at 72°C for 5 minutes. The amplified PCR products were then stored at 4°C until further analysis (Xue et al., 2024).
Presented below is the sizes of the amplified DNA fragments, determined by comparing the bands to the DNA ladder.
| Gene | Primer Sequence (5'→3') | Band Size (bp) | Reference |
|---|---|---|---|
| cagA | Forward: CTGCAAAAGATTGTTTGGCAGA | 349 | Green et al. (2019) |
| Reverse: CTGCAAAAGATTGTTTGGCAGA |
Gel Electrophoresis of PCR Products
Agarose gel electrophoresis was used to analyze PCR products. A 3% agarose gel was prepared by mixing 3 g of agarose powder with 100 mL of 1X TAE buffer in a microwavable flask and heating it in a microwave until the agarose was completely dissolved. After allowing the solution to cool to approximately 50°C, 5 μL of ethidium bromide (0.5 μg/mL) was added to the gel mixture to enable visualization under UV light. The gel was then poured into a gel tray with a well comb in place and left to solidify at room temperature for 20 minutes (Green & Sambrook, 2019).
Once solidified, the gel was placed in the gel box, and the electrophoresis chamber was filled with 1X TAE buffer until the gel was completely submerged. The PCR products were mixed with a loading buffer and carefully loaded into the wells of the gel along with a 1 kb DNA ladder (Fermentas, Germany) in the first lane. The gel was run at 150 V for 1 to 1.5 hours, or until the dye front had migrated approximately 75-80% of the gel length. After electrophoresis, the gel was removed and placed in a gel documentation system (BioRad, USA) for visualization under UV light. The sizes of the amplified DNA fragments were determined by comparing the bands to the DNA ladder.
Data obtained from the questionnaires and the serological findings recorded on the data entry forms were entered into Microsoft Excel 23 and subsequently analyzed using SPSS 23. Each form was assigned a unique identifier corresponding to the patient or laboratory number. Numerical data are expressed as means, standard deviations (±SD), and ranges. Categorical variables are presented as proportions and were analyzed using the Chi-square test. Statistical significance was determined at a p-value of less than 0.05. The Chi-square test was the primary statistical tool employed for analysis in this study.
Table 1.0 presents the distribution of patients by gender, marital status, educational level, religion, occupation, and ethnicity. The participants' ages ranged from 18 to 83 years, with a mean age of 35.5 years. The median and modal age group was 31–40 years, which also exhibited the highest prevalence of H. pylori infection at 31.5%. Among males, the ages ranged from 18 to 83 years, while female participants ranged from 18 to 70 years old. The study cohort comprised 206 males (68.2%) and 96 females (31.8%). The highest infection prevalence, 78.0%, was recorded within the 31–40 age group.
Table 2.0 presents the prevalence of H. pylori infection across different socio-demographic groups within the study population. The 31–40 age group recorded the highest prevalence, accounting for 31.5% of infections among 95 dyspeptic patients. Of the total 302 participants, 206 were male (68.2%) and 96 were female (31.8%), resulting in a male-to-female ratio of approximately 2.1:1.
Table 3.0 outlines the clinical characteristics of the dyspeptic patients. A total of 18 respondents (5.94%) were identified as having co-existing medical conditions. Among them, 2 patients (0.66%) had systemic hypertension, 1 patient (0.33%) had type 2 diabetes mellitus, 4 patients (1.32%) had sickle cell disease, and 8 patients (2.64%) were diagnosed with malaria. Additionally, 1 patient each (0.33%) had typhoid fever, hepatitis, and bronchial asthma, respectively.
Table 4.0 presents the clinical symptoms reported by respondents, as listed in the questionnaire. Two hundred and thirty two respondents 232(100% of the positive patients) had one or more co-existing medical illnesses; 95 of the respondents had systemic hypertension (40.95%), 85 of the respondents had Postprandial fullness (36.64%), 4 of the respondents had Dysphagia (1.72%), 10 of the respondents had early satiety (4.31%), 30 of the respondents had History of peptic ulcer (12.93%), 8 of the respondents had cigarette smoking habit (3.44%).
Table 1.0: Socio-demographics Characteristics of the suspected Dyspeptic Patients
| Variables | N= 302 | % | p-value |
|---|---|---|---|
| Age Range (Years) | |||
| 11-20 | 52 | 17.2 | |
| 21-30 | 84 | 27.8 | |
| 31-40 | 95 | 31.5 | |
| 41-50 | 49 | 16.2 | |
| 51-60 | 9 | 3.0 | |
| 61-70 | 6 | 2.0 | |
| 71-80 | 4 | 1.3 | |
| 81-90 | 3 | 1.0 | |
| 0.336* | |||
| Gender | |||
| Female | 96 | 31.8 | |
| Male | 206 | 68.2 | 0.354* |
| Marital Status | |||
| Single | 90 | 29.8 | |
| Married | 201 | 66.6 | |
| Divorced | 4 | 1.3 | |
| Widowed | 7 | 2.3 | 0.002 |
| Educational Status | |||
| Informal | 172 | 57.0 | |
| Primary | 82 | 27.2 | |
| Secondary | 41 | 13.6 | |
| Tertiary | 7 | 2.3 | 0.000 |
| Religion | |||
| Islam | 300 | 99.3 | |
| Christianity | 2 | ||
| Occupation | |||
| Civil Servants | 5 | 1.7 | |
| Farmers | 205 | 67.9 | |
| Others | 92 | 30.5 | 0.000 |
| Ethnicity | |||
| Hausa/Fulani | 299 | 99.0 | |
| Others | 3 | 1.0 | 0.200* |
Key: %=percentage, N=No of patients, * = statistically significant
Table 2.0 : Prevalence of H. pylori infection based on the Socio-demographic Characteristics of the Dyspeptic Patients in Dutse General Hospital
| VARIABLES | Positive | Negative | total | X2 | dF | P-value |
|---|---|---|---|---|---|---|
| AGE RANGE (YEARS) | ||||||
| 11-20 | 39 | 13 | 52 | 6.47267941 | 7 | 0.4857628* |
| 21-30 | 63 | 21 | 84 | |||
| 31-40 | 78 | 17 | 95 | |||
| 41-50 | 33 | 16 | 49 | |||
| 51-60 | 7 | 2 | 9 | |||
| 61-70 | 5 | 1 | 6 | |||
| 71-80 | 4 | 0 | 4 | |||
| 81-90 | 3 | 0 | 3 | |||
| Total | 232 | 70 | 302 | |||
| GENDER | ||||||
| Female | 72 | 24 | 96 | 0.26215027 | 1 | 0.60864672* |
| Male | 160 | 46 | 206 | |||
| Total | 232 | 70 | 302 | |||
| MARITAL STATUS | ||||||
| Single | 79 | 11 | 90 | 16.3753403 | 3 | 0.00094975 |
| Married | 148 | 53 | 201 | |||
| Divorced | 3 | 1 | 4 | |||
| Widowed | 2 | 5 | 7 | |||
| Total | 232 | 70 | 302 | |||
| EDUCATIONAL STATUS | ||||||
| Informal | 150 | 22 | 172 | 38.2941845 | 3 | 2.4488-08* |
| Primary | 60 | 22 | 82 | |||
| Secondary | 20 | 21 | 41 | |||
| Tertiary | 2 | 5 | 7 | |||
| Total | 232 | 70 | 302 | |||
| RELIGION | ||||||
| Islam | 232 | 68 | 300 | 6.6727619 | 1 | 0.00978974 |
| Christianity | 0 | 2 | 2 | |||
| Total | 232 | 70 | 302 | |||
| OCCUPATION | ||||||
| Civil Servants | 4 | 1 | 5 | 14.1279802 | 2 | 0.00085536 |
| Farmers | 170 | 35 | 205 | |||
| Others | 58 | 34 | 92 | |||
| Total | 232 | 70 | 302 | |||
| ETHNICITY | ||||||
| Hausa/Fulani | 232 | 67 | 299 | 10.0426183 | 1 | 0.0015296 |
| Others | 0 | 3 | 3 | |||
| Total | 232 | 70 | 302 |
Key: %=percentage, X2=Chi square, N=No of Patients, * = statistically significant
Table3.0 Presence of Co-existing medical conditions among dyspeptic patients
| Co-existing Condition | Positive | Negative | Total | X2 | dF | P-value |
|---|---|---|---|---|---|---|
| Systemic hypertension | 2 | 1 | 3 | 4.5 | 1 | 0.6093* |
| Type 2 DM | 1 | 2 | 3 | |||
| Sickle cell disease | 4 | 0 | 4 | |||
| Malaria | 8 | 4 | 12 | |||
| Typhoid fever | 1 | 1 | 2 | |||
| Hepatitis 1 | 1 | 1 | 2 | |||
| Bronchial asthma | 1 | 0 | 1 | |||
| Total | 18 | 9 | 27 |
Key: %=percentage, X2=Chi square, N=No of Patients, * = statistically significant
Clinical Symptoms presented by respondents as contained in the questionnaire
Table 4.0 Clinical Symptoms presented by respondents as contained in the questionnaire
| Clinical Symptoms | Seropositive N (%) | Seronegative N (%) |
X2 | P-value |
|---|---|---|---|---|
| Epigastric pain | 95(40.95) | 0(0.00) | 171.2 | 0.00 |
| Postprandial fullness | 85(36.64) | 0(0.00) | 123.6 | 0.00 |
| Dysphagia | 4(1.72) | 0(0.00) | 24.6 | 0.00 |
| Early satiety | 10(4.31) | 0(0.00) | 14.2 | 0.00 |
| Vomiting | 0(0.00) | 0(0.00) | 464.- | 0.00 |
| History of peptic ulcer | 30(12.93) | 0(0.00) | 43.5 | 0.00 |
| Cigarette smoking | 8(3.44) | 0(0.00) | 216.3 | 0.00 |
| Drinking alcohol | 0(0.00) | 0(0.00) | 464.0 | 0.00 |
Key: %=percentage, X2=Chi square, N=No of Patients, * = statistically significant
Figure 2: Amplified DNA fragment detected
key: bp = base pair (band), M = main ladder, + = positive control, - = negative control, 1 = sample one, 2 = sample two, 3 = sample three
The participants' ages ranged from 18 to 83 years, with a median age of 31–40 years and a mean age of 35.5 years. The findings indicate that patients aged 31–40 years are at a higher risk of dyspepsia, as 25.8% of the 78 seropositive patients were within this age range, and the highest prevalence of infection (78.0%) was found in this group. The study population comprised 206 males (68.2%) and 96 females (31.8%), reflecting a higher male representation. This male-to-female seroprevalence ratio is slightly lower compared to studies from Maiduguri (Embiyale, 2019), Kano (Tijjani et al., 2005), and Ibadan (Otegbayo et al., 2004), where the prevalence of H. pylori infection among male dyspeptic patients was also higher than that of females, with corresponding male prevalences of 51.8%, 53.7%, and 61.8%, respectively.
In a study by Ndububa et al. (2001), the prevalence of H. pylori in Ile-Ife, South-West Nigeria, was found to be 73% using histology and the Campylobacter-like organism (CLO) urease test on gastric mucosal biopsies. This prevalence was lower than that observed in the current study. Similarly, Ugwu et al. (2007) reported an overall H. pylori prevalence of 26.3% in Abakaliki, Nigeria, which was also lower than the prevalence found in this study. Interestingly, in the present study, the 31–40 age group had the highest H. pylori positivity, with 78 respondents (25.8%) and a mean age of 35.5 years, suggesting they are at a greater risk compared to older age groups. This contrasts with the findings of Ugwuja et al. (2007), who reported a significantly higher prevalence of H. pylori infection in older patients compared to those aged ≤ 20 years, with rates of 29% versus 11%, respectively, and a mean patient age of 38.6 ± 5.2 years.
The prevalence of H. pylori infection is highly variable worldwide, with significantly higher rates in developing countries, where it can reach up to 90%, compared to lower rates in industrialized nations (Secka et al., 2013). For example, the prevalence in South America, Bangladesh, and Pakistan is approximately 80%, which is higher than the prevalence observed in this study. In contrast, countries such as Switzerland (26%), Sweden (11%), and France (20–50%) report lower rates of H. pylori infection (Sherif et al., 2004). In Nigeria, studies have shown varying prevalence rates. Bello et al. (2018) reported a prevalence of 81.7% in Kano, which is higher than the 78.0% found in this study. Akpa et al. (2023) reported a 73% prevalence in Ile-Ife, while a study in Kaduna found a lower prevalence than in the current research. Additionally, studies in Orlu, Imo State, by Obiajuru and Adogu (2013) and in Akwa, Anambra State, by Chukwuma et al. (2020) reported prevalence rates of 58% and 51.4%, respectively, which are both lower than the 78% observed in this study. In other African countries, reports include a 75.4% prevalence in Ghana (Baako and Danko, 1996), which is slightly lower than the findings here, while rates in Egypt (>80%, Khedmat et al., 2013) and The Gambia (97%, Secka et al., 2013) were higher. Finally, Shi et al. (2008) reported a 62% prevalence in China, which is also lower than the rate found in this research.
Eighteen respondents (5.94% prevalence) were found to have co-existing medical conditions. These included 2 patients (0.66%) with systemic hypertension, 1 patient (0.33%) with type 2 diabetes mellitus (DM), 4 patients (1.32%) with sickle cell disease, 8 patients (2.64%) with malaria, 1 patient (0.33%) with typhoid fever, 1 patient (0.33%) with hepatitis, and 1 patient (0.33%) with bronchial asthma. Additionally, 232 respondents (100% of the seropositive patients) had one or more co-existing medical symptoms with associated risk factors for H. pylori infection. Among these, 95 patients (40.95%) had systemic hypertension, 85 patients (36.64%) reported postprandial fullness, 4 patients (1.72%) experienced dysphagia, 10 patients (4.31%) had early satiety, 30 patients (12.93%) had a history of peptic ulcers, and 8 patients (3.44%) were cigarette smokers.
H. pylori infection is widespread globally, affecting approximately 90% of the population, with a higher prevalence in developing countries such as Nigeria. This higher rate is likely due to the fecal-oral transmission route and inadequate sanitation conditions in these regions (Secka et al., 2013). Numerous studies conducted in Brazil and worldwide aim to better understand the disease's pathogenesis, examine epidemiological and diagnostic factors, and reduce the incidence of H. pylori infections, thereby improving patient outcomes. In Iran, the seroprevalence of H. pylori in the pediatric population exceeds 65% (Salahi-Niriet al., 2024). The prevalence of the infection is notably uneven across the globe, with rates in developing countries reaching up to 90%, while in industrialized nations, the rates are considerably lower (Secka et al., 2013).
Good hygiene practices, adequate nutritional status, drinking natural water free of contamination, should be improved in the area, screening younger dyspeptic patients to eliminate further complications, evaluation of the assay efficacy in younger patients is more clinically relevant, and public awareness on the risk factors, mode of transmission and causes of H. pylori infection in the study area.
Humans serve as the primary reservoir for H. pylori. The prevalence of H. pylori infection varies significantly based on geographic location, age, and gender.The results of this study reveal a high prevalence of H. pylori infection in the studied area, suggesting the need for further analysis. Therefore, it is recommended that additional epidemiological interventions and clinical prevention measures be implemented to control the transmission of the organism in the region. H. pylori serology represents a rapid, non-invasive test for determining the colonization of the organism.
1. It is therefore recommended that early Serologic screening and diagnosis of younger dyspeptic patients are clinically relevant.
2. Good hygienic and nutritional practices should be encouraged to reduce the risk of dyspeptic infection.
3. Public awareness of the risk factors, mode of transmission, and causes of H. pylori infection in the study area.
Akpa, O. M., Okekunle, A. P., Sarfo, F. S., Akinyemi, R. O., Akpalu, A., Wahab, K. W., & SIREN study as part of the H3Africa consortium. (2023). Sociodemographic and behavioural risk factors for obesity among community-dwelling older adults in Ghana and Nigeria: A secondary analysis of data from the SIREN study. Chronic Illness, 19(1), 40–55. [Crossref]
Ali, A., & AlHussaini, K. I. (2024). Helicobacter pylori: A contemporary perspective on pathogenesis, diagnosis and treatment strategies. Microorganisms, 12(1), 222. [Crossref]
Azami, M., et al. (2024). A novel plasmid extraction method for efficient isolation of high-quality plasmid DNA from Helicobacter pylori. Molecular Biology Reports, 51(1), 123.
Azami, Z., Farahmand, M., & Kavousi, M. (2024). A new multi-epitope DNA vaccine against Helicobacter pylori infection in a BALB/c mouse model. Heliyon, 10(21). [Crossref]
Baako, B. N., & Darko, R. (1996). Incidence of Helicobacter pylori infection in Ghanaian patients with dyspeptic symptoms referred for upper gastrointestinal endoscopy. West African Journal of Medicine, 15(4), 223–227.
Bello, A. K., Umar, A. B., & Borodo, M. M. (2018). Prevalence and risk factors for H. pylori infection in gastroduodenal diseases in Kano, Nigeria. African Journal of Medical and Health Sciences, 17, 41–46. [Crossref]
Chukwuma, O. M., Chukwuma, G. O., Manafa, P. O., Akulue, J. C., & Jeremiah, Z. A. (2020). Prevalence and possible risk factors for H. pylori sero positivity among peptic ulcerative individuals in Nnewi, Nigeria. Biomedical Research Journal, 4(1), 166–172.
Duan, M., Li, Y., Liu, J., Zhang, W., Dong, Y., Han, Z., & Li, Y. (2023). Transmission routes and patterns of Helicobacter pylori. Helicobacter, 28(1), e12945. [Crossref]
Embiyale, M. A. (2019). Prevalence of premarital sexual practice and its associated factors among senior students in Alage Technical Vocational Education Training College, Ministry of Agriculture and Natural Resource, Ethiopia. Prevalence, 9(19), 32–46.
Green, M. R., & Sambrook, J. (2019). Analysis of DNA by agarose gel electrophoresis. Cold Spring Harbor Protocols, 2019(1), pdb.top100388. [Crossref]
Green, M. R., & Sambrook, J. (2019). Polymerase Chain Reaction. Cold Spring Harbor Protocols, 2019(6), pdb.top095109. [Crossref]
Khedia, J., Gupta, R., & Anand, G. (2025). Exploration of the microbial urease and their industrial applications. In Microbial enzymes: Production, purification and industrial applications (Vol. 1, pp. 31–46). [Crossref]
Khedmat, H., Karbasi-Afshar, R., Agah, S., & Taheri, S. (2013). Helicobacter pylori Infection in the general population: A Middle Eastern perspective. Caspian journal of internal medicine, 4(4), 745–753.
Kouitcheu Mabeku, L. B., Pohoko Foguieng, K. N., Kouam Mewa, J. E., & Koki Ndombo, P. O. (2025). Rate of Helicobacter pylori acquisition in children and evidence of mother-child transmission in a Sub-Saharan setting. Future Science OA, 11(1), 2482497. [Crossref]
Leja, M., Grinberga-Derica, I., Bilgilier, C., & Steininger, C. (2019). Epidemiology of Helicobacter pylori infection. Helicobacter, 24, e12635. [Crossref]
Malone, D. J. (2024). Gastrointestinal diseases and disorders. In Acute care physical therapy (pp. 459–510). Routledge. [Crossref]
Mladenova, I. (2021). Clinical relevance of Helicobacter pylori infection. Journal of Clinical Medicine, 10(16), 3473. [Crossref]
Ndububa, D. A., Yakicier, C. M., Ojo, O. S., Adeodu, O. O., Rotimi, O., Ogunbiyi, O., & Ozturk, M. (2001). p53 codon 249 mutation in hepatocellular carcinomas from Nigeria.
Obiajuru, I. O. C., & Adogu, P. O. U. (2013). Prevalence of H. pylori and other intestinal parasite amongst duodenal and gastric ulcer patients at Imo State University Teaching Hospital, Orlu, South-Eastern Nigeria. Journal of Medicine and Medical Sciences, 4, 362–369.
Olumoh, J., Adeyemi, R., Aliu, R., & Oguche, S. (2025). Mathematical modeling and estimation of the regional variations in COVID-19 infections transmission in Nigeria: A retrospective data analysis. NIPES-Journal of Science and Technology Research, 7(1), 176–191. [Crossref]
Otegbayo, J. A., Oluwasola, O. A., Yakubu, A., Odaibo, G. N., & Olaleye, O. D. (2004). H. pylori serology and evaluation of gastro-duodenal disease in Nigerians with dyspepsia. African Journal of Clinical and Experimental Microbiology, 5(1), 126–133. [Crossref]
Parisi, R., Iskandar, I. Y., Kontopantelis, E., Augustin, M., Griffiths, C. E., & Ashcroft, D. M. (2020). National, regional, and worldwide epidemiology of psoriasis: Systematic analysis and modelling study. BMJ, 369. [Crossref]
Rafeey, M., Ghotaslou, R., & Farhang, S. (2013). Prevalence of Helicobacter pylori infection in children with dyspepsia in a developing country. World Journal of Pediatrics, 9(2), 162-166.
Retnakumar, R. J., Nath, A. N., Nair, G. B., & Chattopadhyay, S. (2022). Gastrointestinal microbiome in the context of Helicobacter pylori infection in stomach and gastroduodenal diseases. Progress in Molecular Biology and Translational Science, 192(1), 53–95. [Crossref]
Reyes, V. E. (2023). Helicobacter pylori and its role in gastric cancer. Microorganisms, 11(5), 1312. [Crossref]
Saad, M., El-Dahshan, A., & El-Khadrawy, S. (2008). Prevalence of Helicobacter pylori infection among asymptomatic individuals in Ismailia, Egypt. Journal of the Egyptian Society of Parasitology, 38(3), 859-868.
Salahi-Niri, A., Nabavi-Rad, A., Monaghan, T. M., Rokkas, T., Doulberis, M., Sadeghi, A., & Yadegar, A. (2024). Global prevalence of Helicobacter pylori antibiotic resistance among children in the World Health Organization regions between 2000 and 2023: A systematic review and meta-analysis. BMC Medicine, 22(1), 598. [Crossref]
Secka, O., Berg, D. E., Antonio, M., Corrah, T., Tapgun, M., Walton, R., et al. (2013). Antimicrobial susceptibility and resistance patterns among Helicobacter pylori strains from The Gambia, West Africa. Antimicrobial Agents and Chemotherapy, 57, 1231–1237. [Crossref]
Sherif, M., Mohran, Z., Fathy, H., Rockabrand, D. M., Rozmajzl, P. J., & Frenck, R. W. (2004). Universal high-level primary metronidazole resistance in Helicobacter pylori isolated from children in Egypt. Journal of Clinical Microbiology, 42(10), 4832–4834. [Crossref]
Shi, R., Xu, S., Zhang, H., Ding, Y., Sun, G., & Huang, X. (2008). Prevalence and risk factors for H. pylori infections in Chinese populations. Helicobacter, 13, 157–163. [Crossref]
Smith, S. I., Ajayi, A., Jolaiya, T., Onyekwere, C., Setshedi, M., Schulz, C., & Arigbabu, A. (2022). Helicobacter pylori infection in Africa: Update of the current situation and challenges. Digestive Diseases, 40(4), 535–544. [Crossref]
Swalehe, H. M. (2025). Fecal occult blood and H. pylori in diagnosis and management of peptic ulcer. Lifeline Microbiology, 3(1), 13–29.
Talebi Bezmin Abadi, A. (2018). Diagnosis of Helicobacter pylori using invasive and noninvasive approaches. Journal of Pathogens, 2018(1), 9064952. [Crossref]
Tijjani, B. M., Borodo, M. M., Samaila, A. A., & Mohammed, A. Z. (2005). H. pylori infection in dyspeptic patients at Kano, Nigeria. Borno Medical Journal, 2(1), 14–17.
Ugwuja, E. I., & Ugwu, N. C. (2007). Helicobacter pylori in uninvestigated dyspepsia in primary cares in Abakaliki, Nigeria. Online Journal of Health and Allied Sciences, 1(4). ojhas.org
Xue, J. R., & Marshall, B. (1983). Unidentified curved bacilli on gastric epithelium in active chronic gastritis. The Lancet, 321(8336), 1273–1275. [Crossref]
Xue, Z. J., Gong, Y. N., He, L. H., Sun, L., You, Y. H., Fan, D. J., & Zhang, J. Z. (2024). Amino acid deletions at positions 893 and 894 of cytotoxin-associated gene A protein affect Helicobacter pylori gastric epithelial cell interactions. World Journal of Gastroenterology, 30(41), 4449. [Crossref]
Xue, Z., et al. (2024). Development of a real-time PCR assay for the rapid detection of the cagA gene in Helicobacter pylori strains. Journal of Clinical Microbiology, 62(2), e00876-23.
Zhu, M., Xu, X., Cai, P., Wang, T., Zhu, M., Yan, C., & Jin, G. (2025). Global population structure, virulence factors and antibiotic resistance of Helicobacter pylori: A pooled analysis of 4067 isolates from 76 countries. Helicobacter, 30(2), e70025. [Crossref]