E-ISSN: 2814 – 1822; P-ISSN: 2616 – 0668
ORIGINAL RESEARCH ARTICLE
1Umar Nasir Muhtar*, 1Yusuf Musa Ibrahim, 1Abdulaziz Dantata, 1Tsoho Rabiu Nura and 1Ahmad Mohammed Gumel
1Federal University Dutse, Jigawa, Nigeria
*Corresponding Author: umarmadaki@gmail.com
Typhoid fever remains a significant global health burden, particularly in regions with inadequate sanitation and limited access to safe water supplies. Traditional diagnostic methods, such as blood culture and biochemical assays, although considered the best standards, are labor-intensive and time-consuming, thereby limiting their practical utility in resource-constrained settings. This study aimed to develop a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of S. enterica using conserved genomic regions (367 bp) as targets. Unlike conventional PCR, which requires expensive thermal cyclers, our LAMP protocol utilizes a water bath to maintain a constant reaction temperature of 63°C for 90 minutes, significantly reducing equipment costs. Amplified products were rapidly detected by the addition of SYBR Green dye, which produced a distinct green fluorescence under blue light, enabling easy visual interpretation. Comparative analysis revealed that the LAMP assay demonstrated higher sensitivity—detecting Salmonella in 90% of isolates—compared to 85% for PCR, with both methods showing high specificity and no cross-reactivity with non-Salmonella species. These findings suggest that the LAMP assay provides a rapid, cost-effective, and sensitive alternative for typhoid diagnosis, offering promise for enhanced disease surveillance and management in low-resource settings.
Keywords: Typhoid fever, Salmonella enterica, loop-mediated isothermal amplification (LAMP),, rapid detection.
Introduction
Typhoid fever is a systemic infection caused by the human-restricted pathogen Salmonella entericaserovar Typhi (Manesh et al., 2021) It is primarily transmitted via the faecal-oral route and results in acute systemic infections with potentially life-threatening complications such as intestinal perforations (Sukri et al., 2024) Patients recovering from typhoid fever may also develop a chronic carrier state, contributing to the pathogen's persistence in human populations (Manesh et al., 2021) The disease remains a major global health concern, particularly in low- and middle-income countries where access to clean water and sanitation is inadequate (Debellut et al., 2024) According to the World Health Organization (Murthy et al., 2025), an estimated 9–14 million cases of typhoid fever occur annually worldwide, leading to approximately 110,000–161,000 deaths each year. Children and young adults are the most vulnerable due to weaker immune defenses and increased exposure to contaminated food and water sources. Furthermore, the disease has a high prevalence and transmission rate in Sub-Saharan Africa (SSA), where over 7.2 million cases are reported annually, with an incidence rate of 762 per 100,000 people per year (Mahmoud et al., 2023) This highlights the urgent need for targeted intervention strategies to control the spread of typhoid fever.
The persistence of typhoid fever is strongly linked to inadequate water, sanitation, and hygiene (WASH) infrastructure, particularly in urban slums and rural areas with poor drainage systems and open defecation practices (Debellut et al., 2024) The WHO (2024) emphasizes that improving WASH services is crucial for reducing transmission rates. However, implementing sustainable sanitation infrastructure requires a financial and political commitment, which remains a challenge in many endemic regions. In addition to improving WASH services, vaccination programs, such as the Typhoid Conjugate Vaccine (TCV), have demonstrated significant effectiveness in reducing incidence rates (Murthy et al., 2025). However, access to these vaccines is still limited in some areas due to financial and logistical barriers (Kishore et al., 2024). Despite the availability of antibiotics for treating typhoid fever, the increasing prevalence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) Salmonella enterica serovarTyphi has complicated treatment strategies (Murthy et al., 2025) Therefore, a combination of preventive measures, early detection, and improved antibiotic stewardship is necessary to mitigate the global impact of typhoid fever (Debellut et al., 2024) The disease continues to pose a significant public health challenge in Nigeria, where poor sanitation, antibiotic misuse, and limited healthcare access exacerbate the situation (Akinyemi et al., 2018).
Accurate estimation of the actual burden of typhoid fever and other Salmonella-associated diseases is challenging due to the lack of comprehensive epidemiological surveillance systems, particularly in developing countries (Debellut et al., 2024) In high-income regions such as the United States and Europe, typhoid fever is predominantly diagnosed in travelers returning from endemic areas (Teh et al., 2014) However, in developing nations like Nigeria, typhoid fever remains endemic, particularly in densely populated urban centers with inadequate sanitation facilities and widespread misuse of antibiotics, which accelerate the development of antibiotic-resistant strains. A retrospective study conducted in Lagos, Nigeria, documented over 80,000 cases of Salmonella infections and 800 associated deaths over ten years (Akinyemi et al., 2018). This alarming statistic highlights the urgent need for effective diagnostic and therapeutic strategies to control the spread of the disease. The persistent prevalence of typhoid fever in Nigeria highlights the need for improved diagnostic tools and enhanced public health interventions (Akinyemi et al., 2018; Murthy et al., 2025).
Current conventional methods for identifying S. enterica serovars rely on cell culture, colony counting, and biochemical tests (Cheesbrough, 2006) While these methods are effective, they are labor-intensive, time-consuming, and may take up to a week to yield definitive results (Sayad et al., 2016) These limitations hinder timely diagnosis and management of the disease, particularly in resource-limited settings where laboratory infrastructure is inadequate (Debellut et al., 2024) To address these setbacks, various molecular and immunological methods have been developed, including enzyme-linked immunosorbent assay (ELISA) (Kuhn et al., 2015), microarray immunoassays (Yamasaki et al., 2021), pulsed-field gel electrophoresis (PFGE) (Goay et al., 2016), plasmid analysis (Wang et al., 2018), ribotyping (Shi et al., 2015), polymerase chain reaction (PCR) (Anejo-Okopi et al., 2016), and genome sequencing (Rao & Sun, 2015). For a definitive diagnosis of typhoid fever, WHO recommends bacterial isolation from blood or bone marrow samples. Bone marrow culture, obtained through aspiration of the iliac crest or sternum, is considered the gold standard, with a suggested sensitivity of 90% after four days of culture (Murthy et al., 2025) However, due to the invasive nature of bone marrow biopsies, the diagnosis typically depends on blood culture or the Widal test (Mahmoud et al., 2023) The Widal test, although widely used in developing countries, has limitations in specificity and sensitivity, leading to frequent misdiagnosis and unnecessary antibiotic use (Tegene & Eshetie, 2025).
While PCR has revolutionized pathogen detection with high sensitivity and specificity, its widespread application in low-resource settings is limited by the need for expensive equipment, trained personnel, and sophisticated infrastructure (Neupane et al., 2021). To address these limitations, isothermal nucleic acid amplification techniques such as loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and helicase-dependent amplification (HDA) have emerged as practical alternatives (Neupane et al., 2021; Sohrab et al., 2022).
LAMP stands out among these methods for its speed, sensitivity, and simplicity. It amplifies DNA at a constant temperature (60–65 °C) using 4–6 primers that target 6–8 regions of the gene and a strand-displacing Bst polymerase, producing up to 10⁹ copies in under an hour (Notomi et al., 2015; Oliveira et al., 2021) LAMP requires no thermal cycling or initial denaturation and is less affected by inhibitors, which enhances its robustness in unpurified samples (Oliveira et al., 2021) Furthermore, its results can be visualized through turbidity or simple colorimetric changes, enabling naked-eye detection without sophisticated instrumentation—ideal for field diagnostics (Sohrab et al., 2022).
Compared to LAMP, RPA functions at a lower temperature (37–42 °C) using only two primers and achieves amplification in 20–40 minutes. It is known for its rapid turnaround and tolerance to inhibitors (Sohrab et al., 2022; Zou et al., 2020). However, RPA requires proprietary enzymes and is prone to nonspecific amplification if primers are not highly optimized. HDA, on the other hand, uses helicase and accessory proteins to unwind and amplify DNA but tends to be slower and less sensitive, making it less suitable for rapid diagnostics (Sohrab et al., 2022).
LAMP was selected for this study because it combines high specificity, rapid amplification, and low equipment requirements, making it particularly suitable for detecting Salmonella enterica in resource-limited laboratory environments. Unlike RPA or HDA, LAMP provides a balance of robust amplification, visual result interpretation, and field adaptability (Oliveira et al., 2021; Sohrab et al., 2022; Zou et al., 2020). Its demonstrated superior sensitivity—10 to 100 times that of PCR—further justifies its use in this context (Oliveira et al., 2021).
In this research, we aim to develop a simple yet efficient method for the rapid detection of S. enterica using the LAMP platform. The objectives of this study are therefore (1). To isolate and identify Salmonella enterica using conventional methods. (2) To develop a rapid and efficient LAMP method for detecting S. enterica based on conserved genomic sequences.
Twenty clinical isolates of S. enterica were collected from different hospitals, including Rasheed Shekoni Teaching Hospital (8), General Hospital Dutse (7) and Shirbaline Clinic (5) all in Dutse, Jigawa State, Nigeria. The isolates were first inoculated into Selenite F broth for selection and enrichment, after 24h, each samples was plated onto Salmonella Shigella Agar (SSA), isolates that produced opaque colonies with black centres after 24h were then subcultured onto Xylose Lysine Deoxycholate Agar. After 24h colonies that appeared red in colour with black centres on the XLD were subcultured again onto Nutrient Agar plates to obtain pure cultures. Each culture was subjected to a series of biochemical tests to confirm its identity as S. enterica before proceeding to molecular methods. The biochemical tests included triple sugar iron (TSI) agar for carbohydrate fermentation and hydrogen sulfide (H2S) production, citrate utilization test (CT), urease test (UT), lysine decarboxylase test (LT), indole test (IT), Methyl Red Test (MR) Vogues Proskeur Test (VP) and motility test (MT). These tests represent the current gold standards for confirming the presence of S. enterica (Dhayananth, 2024).
Following biochemical confirmation, DNA extraction was performed using a heat treatment method (Lee et al., (2020). A loopful of bacterial colonies was suspended in 100 µL of double-distilled water, heated at 99 °C for 5 minutes, and immediately chilled on ice for 10 minutes. The crude cell lysate was centrifuged at 13,400 rpm for 3 minutes, and the supernatant containing the extracted DNA was used as the template for PCR and LAMP assays. The purity of the extracted DNA was evaluated using spectrophotometric analysis, as indicated by the A260/A280 ratio, where a value between 1.8 and 2.0 indicates pure DNA (Lee et al., 2020).
For the PCR amplification, Salmonella-specific primers, targeting the flagella antigen gene fliC((Mina et al., 2024) as shown in Table 1 were used. The PCR reaction was carried out in a 25 µL volume containing 1X PCR buffer, 1 mM MgCl2, 0.02 mM of each deoxynucleoside triphosphate (dNTP), 0.4 µM of each primer, 1 U of Taq DNA polymerase, and 5 µL of DNA template (~50 ng/µL). The thermal cycling conditions included an initial denaturation at 95 °C for 5 minutes, followed by 30 cycles of 95 °C for 50 seconds, 55 °C for 1.5 minutes, and 72 °C for 2 minutes, with a final extension at 72 °C for 7 minutes. The PCR products were analyzed on a 1.5% agarose gel and visualized using a gel documentation system (Mina et al., 2024).
Table : Primers for PCR Amplification of fliC Gene from Salmonella Isolates
| Gene | Primers (5′-3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|
| fliC | F: ACTGCTAAAACCACTACT | 367 | (Mina et al., 2024) |
| R: TGGAGACTTCGGTCGCGTAG |
Primers for the loop-mediated isothermal amplification (LAMP) assay targeting Salmonella enterica were adopted from Yang et al. (2018). These primers were validated through BLAST analysis on the NCBI server to ensure specificity to conserved regions of the invA gene. The invA gene was selected due to its critical role as a marker for Salmonella spp. detection in over 74% of published assays. This gene is conserved across multiple Salmonella serovars and offers robust diagnostic reliability (Nagamine et al., 2002).
Table 2: LAMP Assay Primers
| Primer | Sequence (5′-3′) | Notes | Reference |
|---|---|---|---|
| F3 | GAACGTGTCGCGGAAGTC | Forward outer primer | (Yang et al., 2018) |
| B3 | CGCAATAGCGTCACCTT | Reverse outer primer | (Yang et al., 2018) |
| FIP | GCCGCGCATCCGCATCAATA-TCTGGATGGTATGCCCGG | Forward inner primer | (Yang et al., 2018) |
| BIP | GCGAACGCGGAAGCGTACTG-TCGCACCGTCAAAGGAAC | Backward-inner Primer | (Yang et al., 2018) |
| LF | TCAAATCGGGCATCAATACTCATG | Loop forward primer | (Yang et al., 2018) |
| LB | AAAGGGAAGCGCAGCTTTACG | Loop-backward primer | (Yang et al., 2018) |
Loop-mediated isothermal amplification (LAMP) was performed using a Loopamp DNA amplification kit (Eiken Chemical Co., Ltd., Japan). The reaction mixture, with a final volume of 25 µL, consisted of 12.5 µL of 2X reaction mix, 40 pmol of each primer (FIP, BIP, F3, B3, LF, LB), 8 U of Bst DNA polymerase, and 2.5 µL of DNA template. The reaction was incubated at 63°C for 90 minutes in a Scantrik Medical Equipment Laboratory Water Bath model HH-4, followed by enzyme inactivation at 80°C for 2 minutes using a separate Scantrik Medical Equipment Laboratory Water Bath model HH-4. For visualization of the LAMP products, 1 µL of 10X SYBR Green I dye (Guangzhou Dongsheng Biotech Co., Ltd.) was added to each reaction tube after the amplification was completed. The tubes were then gently mixed by pipetting. The presence of amplified DNA was determined by visual inspection under blue light illumination (470 nm) using a VisionMed TI470 Transilluminator. A distinct green fluorescence indicated a positive reaction, while a negative reaction showed no visible fluorescence. The sensitivity of the LAMP assay, along with a comparative PCR assay, was evaluated using known cultures of bacterial isolates. Distilled water was used as a negative control to confirm the absence of contamination during the amplification process. The design and optimization of the LAMP primers followed the principles described by Notomi et al. (2015). The sensitivity of both PCR and LAMP assays was assessed by subjecting known cultures of other bacterial isolates to amplification, with distilled water serving as a negative control (Notomi et al., 2015).
Twenty clinical isolates of Salmonella enterica, obtained from clinical samples collected at Rasheed Shekoni Teaching Hospital, General Hospital Dutse, and Shirbaline Clinic, were subjected to confirmatory identification using a combination of cultural, morphological, and biochemical techniques. The phenotypic evaluation involved both colonial observations on selective media and standardized biochemical assays commonly used in clinical microbiology for identifying enteric pathogens.
On Salmonella-Shigella Agar (SSA), all isolates produced round, colourless colonies that were flat in elevation and dry in texture. The colonies exhibited a non-mucoid appearance, a typical trait of Salmonella species. Gram staining of the isolates revealed they were Gram-negative rods, consistent with the known morphology of S. enterica. On Xylose Lysine Deoxycholate (XLD) agar, the colonies appeared red with characteristic black centres, indicating hydrogen sulfide production.
In the biochemical tests, all isolates produced a triple sugar iron (TSI) reaction characterized by a red slant with a yellow butt and a black precipitate, indicating glucose fermentation with hydrogen sulfide (H₂S) production, but no lactose or sucrose fermentation. Urease activity was negative in all cases, further supporting the identity as Salmonella, which typically lacks urease activity. The Methyl Red (MR) test yielded positive results, indicating the production of stable acids through glucose fermentation. All isolates tested negative for the Voges-Proskauer (VP) test and the Indole test, consistent with the expected biochemical profile of S. enterica. Citrate utilization was positive, indicating the organism's ability to utilize citrate as a sole carbon source. Lysine decarboxylase activity was also positive in all isolates, and motility was confirmed via positive results in the motility test medium, further supporting the identification as motile Salmonella species. Collectively, these cultural and biochemical characteristics matched the classical description of Salmonella enterica, confirming the phenotypic identity of all 20 isolates (Dhayananth, 2024)
Subsequent DNA extraction was performed using a simple heat lysis method. The quality and purity of the extracted DNA were assessed by spectrophotometry, and the A260/A280 ratio ranged from 1.8 to 2.0, indicating the presence of good-quality nucleic acids free from protein contamination. This confirmed that the extraction method was suitable for downstream molecular applications without the need for further purification. PCR amplification was then carried out targeting the fliC gene, which encodes the phase 1 flagellin protein and serves as a reliable molecular marker for S. enterica. Specific primers designed for the fliC gene yielded the expected 367 bp amplicon in 17 of the 20 isolates tested. The PCR products were visualized through agarose gel electrophoresis and are documented in Figure 1. The absence of amplification in two isolates could be attributed to a low template concentration, degraded DNA, or a possible absence/mutation in the target gene region.
Figure 1: Gel Documentation of PCR Products of Salmonella Isolates
Key: Lane M1: DNA Ladder, Lanes 3-12: Clinical Isolates
The LAMP assay was designed to target the invA gene, a well-established diagnostic marker for Salmonella enterica. Positive results were observed in 18 of the 20 isolates, as confirmed through SYBR Green I dye visualization. Representative results are presented in Figure 2.
Figure 2: SYBR Green I dye visualization
The specificity of both PCR and LAMP assays was evaluated using negative controls and non-Salmonella isolates. Both assays displayed specificity for amplification of S. enterica. The results showed that the Lamp assay had more sensitivity than the PCR assay, as 18 (90%) of the isolates showed a change in color to green within 1 hour, while only 17 (85%) of the PCR samples produced amplicons within the expected range.
Table 3: Specificity Testing of PCR and LAMP Assays
| Bacterial Species | PCR Result | LAMP Result |
|---|---|---|
| Salmonella enterica | Positive | Positive |
| Escherichia coli | Negative | Negative |
| Klebsiella pneumoniae | Negative | Negative |
| Staphylococcus aureus | Negative | Negative |
Two (2) of the isolates in this study were subjected to molecular analysis, and the 16S rRNA sequence signified the isolates to have 99.83% and 99.81% similarity with Salmonella enterica subsp enteric serovar Typhi BTSB492 and Salmonella enterica AT MJH isolates in the gene bank with accession numbers PQ628081.1 and LC773422.1, respectively. The accession numbers of the isolates are PV715987 and PV734124, respectively.
Figure 3: Phylogenetic Tree of Salmonella enterica Isolates.
This study aimed to develop a rapid, cost-effective loop-mediated isothermal amplification (LAMP) assay for detecting Salmonella enterica using a water bath instead of a thermal cycler, addressing the need for accessible diagnostic tools in low-resource settings. While conventional microbiological techniques remain the gold standard for Salmonella identification (Bell et al., 2016) Polymerase Chain Reaction (PCR), though highly specific and widely regarded as a superior molecular tool, demands expensive equipment, technical expertise, and may have limitations in detecting low pathogen loads (Sunar et al., 2016) Given these constraints, LAMP has emerged as a viable alternative due to its rapidity, cost-effectiveness, and minimal equipment requirements.
The Polymerase Chain Reaction produced a 367 bp amplicon in 85% of isolates, demonstrating high specificity, as no cross-reactivity was observed with non-Salmonella species. However, its sensitivity was slightly lower than that of the LAMP assay, suggesting that PCR may not always be the most efficient tool for low-burden infections. The LAMP assay detected Salmonella in 90% of isolates, confirming its superior sensitivity compared to PCR. The use of SYBR Green I dye enabled rapid and clear visual differentiation between positive and negative reactions, making it a practical and accessible method for quick diagnosis. The innovative use of a water bath for temperature maintenance reduced costs and improved practicality in resource-limited settings. This finding aligns with those of Ou et al. (2021) and Wang et al. (2018), who reported that LAMP assays offer greater sensitivity and faster results than PCR.
Furthermore, Ou et al. (2021 reported a 97.4% sensitivity for LAMP using real-time fluorescence and 89.5% using visual observation. As such, the 90% sensitivity observed in this research closely aligns with their findings, reinforcing the reliability of our methodology. Similarly, our specificity results align with those of Fan et al. (2015), who demonstrated that LAMP successfully amplified target genes in S. enterica while avoiding nonspecific amplification in non-Salmonella strains, thereby supporting its utility as a diagnostic tool.
However, our LAMP sensitivity was slightly lower than the 97.7% reported by Edel et al. (2023). This variation may be attributed to differences in primer design, target genes, or sample size. Additionally, while our LAMP assay detected Salmonella in 90% of isolates, studies by (Hara-Kudo et al., 2005) demonstrated that LAMP assays could detect Salmonella at levels as low as 10² CFU/mL, significantly lower than the detection limits of conventional PCR (Berenger et al., 2022) This suggests that further optimization of the LAMP assay, including refining primer sequences and enhancing reaction conditions, could improve its sensitivity and broaden its application in clinical diagnostics.
LAMP may be more specific than PCR due to its use of multiple primers targeting six to eight distinct regions of the target gene, compared to PCR’s reliance on two primers (Soroka et al., 2021) This multi-primer approach enhances specificity by reducing the likelihood of nonspecific amplification (Soroka et al., 2021) Additionally, LAMP’s strand-displacement polymerase provides continuous amplification without requiring thermal cycling, reducing the risk of amplification artifacts commonly observed in PCR (Garg et al., 2022) Furthermore, LAMP does not require stringent reaction conditions, making it less susceptible to variations in sample purity and inhibitors, which often affect PCR efficiency (Soroka et al., 2021) These factors collectively contribute to LAMP’s superior specificity and reliability, particularly in complex sample matrices where PCR may fail to amplify due to inhibitory substances (Garg et al., 2022).
Despite LAMP’s advantages, one challenge observed in this study is the need for rigorous primer optimization to ensure maximum specificity. No false positives were recorded, as all positive LAMP reactions corresponded with confirmed Salmonella isolates, indicating high assay accuracy. However, previous studies, such as those by Edel et al. (2023), have reported rare instances of cross-reactions with non-target species in LAMP assays, highlighting the necessity for careful primer selection and extensive validation. Implementing confirmatory techniques, such as sequencing or additional molecular assays, could further enhance diagnostic precision and ensure consistency across diverse sample sources.
Another potential limitation of the LAMP assay is the reliance on subjective visual interpretation of color changes when using SYBR Green I dye. While this method is convenient and cost-effective, real-time fluorescence detection could further enhance accuracy and reduce the likelihood of ambiguous results. Future studies could explore real-time fluorescence detection and integrate digital image analysis to improve sensitivity and specificity.
The confirmation of Salmonella enterica isolates (accesion numbers PV715987 and PV734124) underscores the reliability of the identification methods used in this study. This high degree of similarity validates the accuracy of the isolates' classification and highlights the importance of sequencing in bacterial diagnostics and epidemiological surveillance. The findings also reinforce the effectiveness of the loop-mediated isothermal amplification (LAMP) assay used for rapid Salmonella detection. LAMP demonstrated higher sensitivity than conventional PCR, which aligns with previous studies reporting that LAMP is an efficient and cost-effective diagnostic method for S. entericain clinical and foodborne infections (Wang et al., 2018) The strong agreement between LAMP and sequencing results suggests that LAMP can be a viable alternative to PCR for rapid screening, particularly in low-resource settings where access to thermal cyclers and sequencing facilities is limited. Combining LAMP for initial detection with 16S rRNA sequencing for confirmation provides a practical two-tiered diagnostic approach, where LAMP serves as a rapid, point-of-care tool and sequencing acts as a definitive method in specialized laboratories.
The findings of this study support the integration of molecular diagnostics into routine clinical practice to improve the detection and characterization of Salmonella infections. The combination of phenotypic screening, LAMP, and sequencing provides a more accurate and efficient diagnostic workflow, which is particularly beneficial for regions with limited access to advanced microbiological facilities. The confirmation of S. enterica isolates through sequencing strengthens the case for expanding the use of molecular tools in public health surveillance and outbreak response. Further research should focus on optimizing LAMP for broader applications, refining sequencing methodologies for real-time epidemiological monitoring, and exploring the role of whole-genome approaches in understanding the genetic evolution of Salmonella strains.
This study successfully established a loop-mediated isothermal amplification (LAMP) assay as a rapid, sensitive, and specific method for detecting Salmonella enterica from clinical isolates. While conventional phenotypic methods confirmed the identity of 20 isolates, the LAMP assay demonstrated superior sensitivity (90%) compared to PCR (85%) and enabled faster detection without the need for advanced equipment. Using a simple water bath for isothermal amplification and SYBR Green dye for visual detection, the assay proved highly effective for low-resource settings. The absence of cross-reactivity with non-Salmonella species further affirmed its diagnostic accuracy. These findings support the potential of LAMP as a cost-effective alternative to traditional methods, making it suitable for both clinical and field-based applications where the timely detection of typhoid pathogens is critical.
This research was fully funded by the Tertiary Education Trust Fund (TETFUND) through the Institution-Based Research (IBR) Programme (Grant Number: FUD/VC/RU/ADM.054)
Akinyemi, K. O., Oyefolu, A. O. B., Mutiu, W. B., Iwalokun, B. A., Ayeni, E. S., Ajose, S. O., & Obaro, S. K. (2018). Typhoid Fever: Tracking the Trend in Nigeria. The American Journal of Tropical Medicine and Hygiene, 99(3_Suppl), 41–47. [Crossref]
Anejo-Okopi, J., Okojokwu, J., Ebonyi, A. O., Ejeliogu, E., Isa, S. E., Audu, O., Akpakpan, E. E., Nwachukwu, E. E., Ifokwe, C. K., Ali, M., Lar, P., & Oguche, S. (2016). Molecular characterization of cryptosporidium in children aged 0–5 years with diarrhea in Jos, Nigeria. Pan African Medical Journal, 25. [Crossref]
Bell, R. L., Jarvis, K. G., Ottesen, A. R., McFarland, M. A., & Brown, E. W. (2016). Recent and emerging innovations in Salmonella detection: A food and environmental perspective. Microbial Biotechnology, 9(3), 279–292. [Crossref]
Berenger, B. M., Chui, L., Ferrato, C., Lloyd, T., Li, V., & Pillai, D. R. (2022). Performance of four commercial real-time PCR assays for the detection of bacterial enteric pathogens in clinical samples. International Journal of Infectious Diseases, 114, 195–201. [Crossref]
Cheesbrough, M. (2006). District laboratory practice in tropical countries: Part 2 (2nd ed.). Cambridge University Press. cabidigitallibrary.org
Debellut, F., Friedrich, A., Baral, R., Pecenka, C., Mugisha, E., & Neuzil, K. M. (2024). The cost of typhoid illness in low-and middle-income countries, a scoping review of the literature. PLoS One, 16(6), e0305692.
Dhayananth, B. (2024). Phenotypic and Molecular Characterization of Salmonella serovars Isolated from Pigs, Pork and their Associated Environment. Indian Veterinary Research Institute.
Edel, B., Glöckner, S., Stoll, S., Lindig, N., Boden, K., Wassill, L., Simon, S., Löffler, B., & Rödel, J. (2023). Development of a rapid diagnostic test based on loop-mediated isothermal amplification to identify the most frequent non-typhoidal Salmonella serovars from culture. European Journal of Clinical Microbiology and Infectious Diseases, 42(4), 461–470. [Crossref]
Fan, F., Du, P., Kan, B., & Yan, M. (2015). The development and evaluation of a loop-mediated isothermal amplification method for the rapid detection of Salmonella enterica serovar Typhi. PloS One, 10(4), e0124507. [Crossref]
Garg, N., Ahmad, F. J., & Kar, S. (2022). Recent advances in loop-mediated isothermal amplification (LAMP) for rapid and efficient detection of pathogens. Current Research in Microbial Sciences, 3, 100120. [Crossref]
Goay, Y. X., Chin, K. L., Tan, C. L. L., Yeoh, C. Y., Ja’afar, J. N., Zaidah, A. R., Chinni, S. V., & Phua, K. K. (2016). Identification of five novel Salmonella Typhi-specific genes as markers for diagnosis of typhoid fever using single-gene target PCR assays. BioMed Research International, 2016, 8905675. [Crossref]
Hara-Kudo, Y., Yoshino, M., Kojima, T., & Ikedo, M. (2005). Loop-mediated isothermal amplification for the rapid detection of Salmonella. FEMS Microbiology Letters, 253(1), 155–161. [Crossref]
Kuhn, K. G., Emborg, H. D., Krogfelt, K. A., & Mølbak, K. (2015). Detecting non-typhoid Salmonella in humans by enzyme-linked immunosorbent assays (ELISAs): Practical and epidemiological aspects. Salmonella: Methods and Protocols, 117–126. [Crossref]
Lee, J. E., Mun, H., Kim, S. R., Kim, M. G., Chang, J. Y., & Shim, W. B. (2020). A colorimetric loop-mediated isothermal amplification (LAMP) assay based on HRP-mimicking molecular beacon for the rapid detection of Vibrio parahaemolyticus. Biosensors and Bioelectronics, 151, 111968. [Crossref]
Mahmoud, A., Oluyemisi, A., Uwishema, O., Sun, J., Jobran, A. W., David, S., Wireko, A. A., Adanur, I., Dost, B., & Onyeaka, H. (2023). Recent advances in the diagnosis and management of typhoid fever in Africa: A review. International Journal of Health Planning and Management, 38(2), 317–329. [Crossref]
Manesh, A., Meltzer, E., Jin, C., Britto, C., Deodhar, D., Radha, S., & Rupali, P. (2021). Typhoid and paratyphoid fever: A clinical seminar. Journal of Travel Medicine, 28(2), 12. [Crossref]
Mina, S. A., Debnath, P., Hossain, A. K. M. Z., Hasan, M. Z., & Azad Chowdhury, A. M. M. (2024). Screening and identification of multiple antibiotic-resistant genes containing Salmonella Typhi from drinking water: A severe public health concern in Bangladesh. Heliyon, 10(22), e40523. [Crossref]
Murthy, S., Hagedoorn, N. N., Faigan, S., Rathan, M. D., Marchello, C. S., & Crump, J. A. (2025, February 12). Global typhoid fever incidence: An updated systematic review with meta-analysis. [Crossref]
Nagamine, K., Hase, T., & Notomi, T. (2002). Accelerated reaction by loop-mediated isothermal amplification using loop primers. Molecular and Cellular Probes, 16(3), 223–229. [Crossref]
Neupane, D. P., Dulal, H. P., & Song, J. (2021). Enteric fever diagnosis: Current challenges and future directions. Pathogens, 10(4), 410. [Crossref]
Notomi, T., Mori, Y., Tomita, N., & Kanda, H. (2015). Loop-mediated isothermal amplification (LAMP): Principle, features, and future prospects. Journal of Microbiology, 53(1), 1–5. [Crossref]
Oliveira, B. B., Veigas, B., & Baptista, P. V. (2021). Isothermal amplification of nucleic acids: The race for the next “gold standard.” Frontiers in Sensors, 2. [Crossref]
Ou, H., Wang, Y., Gao, J., Bai, J., Zhang, Q., Shi, L., Wang, X., & Wang, C. (2021). Rapid detection of Salmonella based on loop-mediated isothermal amplification. Annals of Palliative Medicine, 10(6), 6850–6858. [Crossref]
Rao, X., & Sun, J. (2015). Development of SYBR Green I based real-time RT-PCR assay for specific detection of watermelon silver mottle virus. Iranian Journal of Biotechnology, 13(3), 20. [Crossref]
Sayad, A. A., Ibrahim, F., Uddin, S. M., Pei, K. X., Mohktar, M. S., Madou, M., & Thong, K. L. (2016). A microfluidic lab-on-a-disc integrated loop mediated isothermal amplification for foodborne pathogen detection. Sensors and Actuators B: Chemical, 227, 600–609. [Crossref]
Shi, C., Singh, P., Ranieri, M. L., Wiedmann, M., & Moreno Switt, A. I. (2015). Molecular methods for serovar determination of Salmonella. Critical Reviews in Microbiology, 41(3), 309–325. [Crossref]
Sohrab, M., Majidzadeh, K., Morovvati, A., & Soleimani, M. (2022). Real-time loop-mediated isothermal amplification (LAMP) method for quantitative Salmonella Typhi detection based on ViaB gene. Journal of Advanced Biomedical Sciences. [Crossref]
Soroka, M., Wasowicz, B., & Rymaszewska, A. (2021). Loop-mediated isothermal amplification (LAMP): The better sibling of PCR? Cells, 10(8), 1931. [Crossref]
Sukri, L., Banza, A., Shafer, K., Sanoussi, Y., Neuzil, K. M., & Sani, R. (2024). Typhoid intestinal perforation in Francophone Africa, a scoping review. PLOS Global Public Health, 4(3), e0003056. [Crossref]
Sunar, N. M., Stewart, D. I., Fletcher, L. A., Stentiford, E. I., & Ashraf, M. A. (2016). Rapid propidium monoazide cPCR assay for exclusive quantification of viable Salmonella spp. cells. Journal of Environmental Biology, 37(5), 1057.
Tegene, B. A., & Eshetie, M. T. (2025). Evaluating alternatives to the Widal test for typhoid fever diagnosis in developing countries: A targeted literature review. Journal of Public Health in Africa, 16(1), 700. [Crossref]
Teh, C. S. J., Chua, K. H., & Thong, K. L. (2014). Paratyphoid fever: Splicing the global analyses. International Journal of Medical Sciences, 11(7), 732–741. [Crossref]
Wang, Y., Zhang, L., Chen, Y., & Zhang, X. (2018). Comparative evaluation of loop-mediated isothermal amplification and PCR for rapid detection of Salmonella in food samples. Food Control, 90, 119–125.
WHO. (2024). Measures for the control of non-typhoidal Salmonella spp. in poultry meat. Retrieved January 14, 2025, from books.google.com.ng
Yamasaki, E., Matsuzawa, S., Takeuchi, K., Morimoto, Y., Ikeda, T., Okumura, K., & Kurazono, H. (2021). Rapid serotyping of Salmonella isolates based on single nucleotide polymorphism-like sequence profiles of a Salmonella-specific gene. Foodborne Pathogens and Disease, 18(1), 31–40. [Crossref]
Yang, Q., Domesle, K. J., & Ge, B. (2018). Loop-mediated isothermal amplification for Salmonella detection in food and feed: Current applications and future directions. Foodborne Pathogens and Disease, 15(6), 309–331. [Crossref]
Zou, Y., Mason, M. G., & Botella, J. R. (2020). Evaluation and improvement of isothermal amplification methods for point-of-need plant disease diagnostics. PLOS ONE, 15(6), e0235216. [Crossref]