E-ISSN: 2814 – 1822; P-ISSN: 2616 – 0668
ORIGINAL RESEARCH ARTICLE
Yahaya Aliyu1, Ahmed Babangida Suleiman2, Muhammad Sani Aliyu2
1Department of Community Medicine, Federal Teaching Hospital Katsina, Nigeria
2Department of Microbiology, Ahmadu Bello University, Zaria, Nigeria
Corresponding author: aliyuyahaya306@gmail.com
Urinary tract infection (UTI) is a common infectious disease worldwide that affects people of all genders and ages, with women being more frequently affected due to anatomical and physiological factors. Escherichia coli is the most prevalent causative agent of UTIs, followed by Klebsiella pneumoniae, both of which belong to the family Enterobacteriaceae. While K. pneumoniae is less commonly isolated than E. coli, it is often associated with higher levels of antibiotic resistance, which can make treatment more difficult and outcomes potentially more severe in healthcare-associated infections. This study aimed to determine the prevalence and risk factors of Klebsiella pneumoniae in the urine of patients attending Federal Teaching Hospital Katsina, Katsina State, Nigeria. Mid-stream urine samples were collected from 200 patients. Structured questionnaires were administered to gather some socio-demographic and risk factors. The samples were inoculated onto sterile plates of MacConkey agar, incubated at 37 °C for 24 hours, and lactose-fermenting mucoid colonies were suspected to be K. pneumoniae. Gram staining, biochemical tests, and molecular characterisation identified pure isolates. In this study, sixteen (16) isolates, representing a prevalence of 8.0%, were presumptively identified as Klebsiella pneumoniae, while polymerase chain reaction (PCR) confirmed eleven (11) of these isolates, resulting in a confirmed prevalence of 5.5%. Socio-demographic factor that was significantly associated with the prevalence of urinary Klebsiella pneumoniae infection among the patients was the female gender. However, none of the risk factors considered in this study were significantly associated with the prevalence of infection among the study population.
Keywords: UTI, K. pneumoniae, PCR, Prevalence, Risk factors
Klebsiella pneumoniae is a Gram-negative, non-motile, encapsulated bacterium that functions as a facultative anaerobe (Martins et al., 2023). It belongs to the family Enterobacteriaceae K. pneumoniae, often known as Friedlander's bacillus, it was initially identified by Friedlander in 1882 from the pulmonary tissue of a patient who died of pneumonia (Wyres et al., 2024). Gastrointestinal colonisation often precedes K. pneumoniae infections, and the gastrointestinal system is considered the primary reservoir for bacterial transmission (Tian et al., 2024). Klebsiella pneumoniae exhibits several virulence characteristics, including a large polysaccharide capsule found in most clinical isolates, several adhesions, lipopolysaccharide (LPS), and iron-scavenging proteins (Khan et al., 2023).
Klebsiella pneumoniae is an opportunistic microorganism which causes serious disease such as septicemia, pneumonia, urinary tract infection (UTI), chronic lung disorders and nosocomial infection in immunocompromised patients (Russo et al., 2023) Klebsiella pneumoniae has emerged as a significant pathogen in hospitals causing infections that are acquired during hospital stays and are associated with outbreaks affecting 20% of the patient s respiratory tracts being the most commonly affected. The main factors contributing to its pathogenicity are capsular polysaccharide (CPS), lipopolysaccharide (LPS), and fimbriae (Russo et al., 2019).
Urinary tract infections (UTIs) are common bacterial infections that affect a large number of individuals worldwide (Mancuso et al., 2023). The increasing incidence and antibiotic resistance of K. pneumoniae have made it a significant concern in the context of urinary tract infections (UTIs). Klebsiella pneumoniae is a Gram-negative bacterium that possesses the capacity to inhibit and proliferate in the urinary system, resulting in various infections, ranging from uncomplicated bladder irritation to pyelonephritis (Pitout et al., 2015). Klebsiella pneumoniae, belonging to the family Enterobacteriaceae, is a natural inhabitant of the gastrointestinal tract of healthy humans and animals (Martin and Michael 2018). The worldwide occurrence of K. pneumoniae in urinary tract infections (UTIs) has been on the rise, leading to a substantial burden on healthcare systems and highlighting the need for the implementation of efficient management strategies (Trecarichi et al., 2022). Furthermore, the appearance of K. pneumoniae strains that are resistant to many drugs has made the treatment of UTIs more difficult, highlighting the need for understanding the patterns of antibiotic resistance in this disease (Beyene et al., 2023). The objective of this study is to assess socio-demographic and risk factors associated with K. pneumoniae-induced urinary tract infections (UTIs) among patients at the Federal Teaching Hospital, Katsina.
This study was conducted at Federal Teaching Hospital Katsina, located in Katsina State, Nigeria. Katsina is a Local Government Area (LGA) established during Nigeria’s 1976 administrative reforms (National Bureau of Statistics, 2023; Katsina State Government, 2021).
The study population consisted of patients who presented with symptoms of urinary tract infection attending the Federal Teaching Hospital, Katsina State, Nigeria. The study was a hospital-based cross-sectional study. All patients referred to the Microbiology Laboratory at Federal Teaching Hospital Katsina with suspected UTIs and who consented to the study were included. Patients who did not present with any symptoms of UTIs or those with symptoms but did not consent to the study were excluded. Ethical approval was sought from the Management of Federal Teaching Hospital Katsina, Katsina State, Nigeria. Consent of each patient was sought before enrollment into the study.
The sample size of the study was determined by using the formula below and a prevalence of 14.78% (Abdelfattai et al., 2023).
N = [Z2pq]/e2
where:
n = Number of samples
p = Prevalence rate
Z = Standard normal deviate at 95% confidence interval P =14.78%, = 0.147
q = 1-0.147 = 0.853
e = Allowable error for 5% (0.05)
n = [1.962× 0.147×0.853] / 0.052
n = [3.8416×0.147×0.853] / 0.0025
= 191
However, 200 samples were collected for quality and precision.
A structured questionnaire was administered to consenting patients participating in the study. The questionnaire was designed to capture data on socio-demography, risk factors, and symptoms of UTIs associated with K. pneumoniae infection.
Ten millilitres of urine were collected from each participant using sterile containers and a convenient sampling technique (Adeyemi et al., 2021). Samples collected were processed following standard procedures at the Federal Teaching Hospital, Katsina, for the isolation of K. pneumoniae.
Urine samples were cultured onto MacConkey Agar and incubated at 37°C overnight. Mucoid, lactose-fermenting colonies were sub-cultured to obtain pure isolates, which were then inoculated into slant bottles, incubated for 24 hours, and stored at 4°C for preservation (Brown & Smith, 2023).
A thin smear was prepared from a pure bacterial isolate using a wire loop and normal saline on a clean glass slide. After air-drying and heat-fixing, the smear underwent Gram staining: it was stained with crystal violet, treated with Gram’s iodine, decolourized with 95% alcohol, and counterstained with safranin. The slide was then air-dried and examined under a microscope using the oil immersion objective (100×) (Brown & Smith, 2023).
The test organism was grown in 5 mL Peptone water and incubated at 37ᵒC for 24 hours. After incubation, 0.5 mL of Kovac's reagent was added and was gently shaken. A red colour formation in the agent layer above the broth within 1minute indicates a positive test, while the absence of the red layer indicates a negative test (Wright et al., 2017).
The isolates were inoculated in MR-VP broth at 37°C for 48 hours. After incubation, the broth was split into two portions for the Methyl Red (MR) and Voges-Proskauer (VP) tests. Two drops of methyl red indicator were added to one portion; a red color indicated a positive result, while a yellow color indicated a negative result (Bindu and Krishnaiah, 2010).
The Voges-Proskauer (VP) test was performed by adding 0.6 mL of 5% α-naphthol and 0.2 mL of 40% KOH to the second half of the MR-VP broth, followed by vigorous shaking. A red color within 15 minutes indicated a positive result, while no color change signified a negative result (Bindu and Krishnaiah, 2010).
Each isolate was first streaked on Nutrient Agar and incubated at 37°C for 24 hours. A colony was then transferred to Simmon Citrate medium and incubated under the same conditions. A color change from green to blue indicated a positive result (citrate utilization), while no color change indicated a negative result (MacWilliams, 2015).
Molecular detection of Klebsiella pneumoniae was done by conventional PCR using K. pneumoniae specific primers (Amani et al., 2016). Bacterial DNA was amplified in a 20 μL reaction mix containing Taq buffer, dNTPs, primers (249bp), and lysate, using a thermal cycler (25 cycles: 94°C denaturation, 58°C annealing, 60°C extension). Products were electrophoresed, stained with ethidium bromide, and visualized under UV (Yusuf et al., 2018).
Extraction of DNA from K. pneumoniae A single colony was suspended in 200 µL distilled water, colony was emulsified to create a homogenous suspension heat-lysed at 100°C for 10 min, cooled on ice, and centrifuged (10,000 rpm, 10 min) The resulting supernatant, containing crude genomic DNA, was carefully collected and used as the template for downstream PCR applications (Brown and Smith, 2023; Khan et al., 2023; Munoz-Price et al., 2023).
DNA fragments and their primers were analyzed using agarose gel electrophoresis (1.5%). Ethidium bromide (0.5 μg/mL) was used to stain the DNA for visualization under UV light. The gel was prepared with TAE buffer, and DNA samples were loaded into wells. Electrophoresis was run at 80–150 V for 1 hour. Afterward, the gel was viewed under UV light, and a DNA ladder in the first lane served as a reference for interpreting the bands (Magdeldin, 2012).
| Gene | Primers Sequence | Amplicon Size | Reference |
|---|---|---|---|
| yhaI | F- ATTTGAGCGGCTGGAAAGAG | 249bp | Poirier et al., 2022 |
| R- AGCGGCCGATATCATGCAT |
Odds ratio (OR) analysis was conducted to assess the association between Klebsiella pneumoniae infection and various socio-demographic and risk factors using IBM SPSS Version 24. The final results were presented in simplified form using tables and charts.
Out of the 200 urine samples analyzed, eleven (11) isolates were confirmed as Klebsiella pneumoniae by molecular technique (PCR), indicating a prevalence of 5.5%, as shown in Figure 1 and Plate 1.
Figure 1: Prevalence of K. pneumoniae
Plate I: Amplified fragment of yhaI of Klebsiella pneumoniae
Expected amplicon size (249bp)
M = Molecular marker size of (100bp)
NC = Nuclease-free water as negative control
Lane:- 2, 3, 4, 5, 6, 7, 8, 12, 13, 15, and 16: Positive
Lane: - 1, 9, 10, 11, and 14 : Negative
The study demonstrated in Table 1, a notably higher prevalence of Klebsiella pneumoniae infection among female patients (7.8%) compared to their male counterparts (1.4%), despite males showing a greater likelihood of infection (OR = 6.017). The highest infection rate was recorded among participants with informal education (7.3%), though the variations across educational levels were not statistically significant. In terms of age distribution, individuals aged 32–45 years had the highest prevalence (8.0%), followed by those aged 18–31 years (7.1%) and 46–59 years (2.9%).
Table 1: Socio-demographic Distribution of Klebsiella pneumoniae in Urine of Patients Attending Federal Teaching Hospital Katsina
| Demographic factors | Number examined | Number Positive (%) | χ2 | Df | P- value |
|---|---|---|---|---|---|
| Gender | |||||
| Female | 128 | 10 (7.8) | |||
| Male | 72 | 1 (1.4) | 3.658 | 1 | 0.050 |
| Level of education | |||||
| Informal | 82 | 6 (7.3) | |||
| Primary | 5 | 0 (0.0) | |||
| Secondary | 66 | 4 (6.1) | |||
| Tertiary | 47 | 1 (2.1) | 1.880 | 3 | 0.598 |
| Age group (years) | |||||
| 4 – 17 | 15 | 0(0) | |||
| 18 – 31 | 42 | 3(7.1) | |||
| 32 – 45 | 75 | 6(8.0) | |||
| 46 – 59 | 68 | 2(2.9) | 2.850 | 3 | 0.415 |
aOR = 0.166 (0.021 – 1.326); bOR = 6.017
The study found higher occurrences of Klebsiella pneumoniae infection among diabetic patients (6.7%) compared to non-diabetics (5.4%), and among those with prolonged antibiotic use (7.7%) versus those without (2.4%). Pregnant patients (9.1%) and those with a history of catheter use (11.1%) also showed higher infection rates compared to their counterparts. However, none of these factors—diabetes, prolonged antibiotic use, pregnancy, or catheterization were statistically significant risk factors for infection, as all had p> 0.05 and Odds Ratios (OR<1) Table 2.
Table 2: Risk Factors of urinary Klebsiella pneumoniae infection among patients attending Federal Teaching Hospital Katsina
| Risk Factors | Number Examined | Number Positive (%) | Odd-ratio | χ2 | df | p-value |
|---|---|---|---|---|---|---|
| Diabetes | ||||||
| No | 185 | 10 (5.4) | 1.250 | 0.042 | 1 | 0.837 |
| Yes | 15 | 1 (6.7) | 0.800 | |||
| Prolonged antibiotic use | ||||||
| No | 83 | 2 (2.4) | 3.375 | 2.607 | 1 | 0.106 |
| Yes | 117 | 9 (7.7) | 0.296 | |||
| Pregnancy | ||||||
| No | 156 | 7 (4.5) | 2.129 | 1.388 | 1 | 0.237 |
| Yes | 44 | 4 (9.1) | 0.470 | |||
| History of Catheterization | ||||||
| No | 182 | 9 (4.9) | 2.403 | 1.198 | 1 | 0.274 |
| Yes | 18 | 2 (11.1 | 0.416 | |||
The study recorded a 5.5% prevalence of Klebsiella pneumoniae-associated urinary tract infections (UTIs). This relatively low prevalence may be attributed to effective antibiotic stewardship programs that limit the spread of resistant strains, as well as strong host immune responses that help eliminate the infection. (Bolton et al., 2019). Compared to this study's findings, higher prevalence rates of Klebsiella pneumoniae infection have been reported in other parts of Nigeria. A similar study conducted in Kano State by Hamza and Abdulhadi (2016) recorded a 7.0% prevalence.
The prevalence in this study is consistent with the one carried out in Jimma University Specialist Hospital, Jimma in Ethiopia, which reported a prevalence of 5.3% (Ragas et al., 2015). A higher prevalence of 18.2% was also reported in different research studies performed in Anambra, Nigeria (Ogbuka et al., 2016). A study carried out in the Federal Capital Territory in Abuja showed a prevalence of 21.0% (Ajobiew et al., 2020). Also, Abdulfatai et al. (2023) conducted research in Kaduna and reported a prevalence of 14.78%. Differences in Klebsiella pneumoniae prevalence across studies may be due to varying environmental conditions and risk factors specific to each region where the research was conducted. This study found a higher prevalence of Klebsiella pneumoniae infection in females (7.8%) compared to males (1.4%), aligning with findings by Hamza and Abdulhadi (2016), but contrasting with Chang-Phone et al. (2012), who reported a higher prevalence in males (57.6%).
The increased prevalence in females is commonly linked to anatomical factors, such as a shorter urethra and closer proximity of the urethral opening to the anus, which facilitate microbial colonization. The study observed a higher prevalence of Klebsiella pneumoniae infection among individuals with informal education, followed by those with secondary and tertiary education, while no cases were found among those with primary education. This suggests that educational background may influence awareness and adoption of protective measures, with individuals having formal education more likely to practice effective UTI prevention. The study recorded the highest prevalence of Klebsiella pneumoniae infection among individuals aged 32–45 years, consistent with findings by Aneke et al. (2022). This was followed by those aged 18–31 years and then by patients aged 46–59 years. No infections were observed in the youngest group (4–17 years). The results support existing evidence that UTIs are more common among young and middle-aged adults, as also noted by Akoachere et al. (2012). However, Loveth et al. (2023) reported a peak prevalence in the 21–30 age group, highlighting some variation across studies. Klebsiella pneumoniae is increasingly recognized as a common cause of urinary tract infections (UTIs), particularly among hospitalized patients with a history of urinary catheter use in Nigeria. Catheter-associated urinary tract infections (CAUTIs) remain a significant issue in Nigerian healthcare facilities, largely due to the widespread use of indwelling catheters in surgical wards, intensive care units, and long-term care settings (Onuoha and Fatokun, 2014). Research from various regions of Nigeria has consistently shown a high prevalence of Klebsiella pneumoniae among catheterized patients. In a study conducted in Southwestern Nigeria, Oluwasemowo et al. (2023) identified K. pneumoniae as the second most common isolate, exhibiting significant resistance to commonly used antibiotics. The high rates of colonization and infection have been linked to prolonged catheter use and inadequate adherence to aseptic techniques (Iregbu et al., 2013). Similarly, a study in Jos, North Central Nigeria, reported that K. pneumoniae made up over 20% of isolates from catheterized individuals (Aliyu et al., 2017).
Recent research in Nigeria underscores the prominent role of Klebsiella pneumoniae as a uropathogen among diabetic patients. In a study conducted at a university medical center in Awka, Anambra State, K. pneumoniae was isolated in 11.4% of diabetic UTI cases, compared to 10.71% in non-diabetics. Overall, diabetics had a higher UTI prevalence (61.1%) than non-diabetics (38.9%), suggesting diabetes is a notable risk factor for UTIs (Ezebialu et al., 2024). Similarly, a study in Enugu reported Klebsiella species accounted for 16.9% of uropathogens in diabetic patients, significantly exceeding the 6% found in non-diabetics (Okwume et al., 2021). Overall, the evidence highlights Klebsiella pneumoniae as a major uropathogen among diabetic patients in Nigeria. Its increased prevalence is likely linked to diabetes-related factors such as weakened immune function, glycosuria, and other complications that heighten susceptibility to infection (Okwume et al., 2021). Additionally, frequent use of broad-spectrum antibiotics in the country has contributed to the emergence of multidrug-resistant (MDR) K. pneumoniae strains, which are more challenging to treat and often associated with recurrent or complicated urinary tract infections.
Recent studies in Nigeria have established a strong link between prior antibiotic use and the emergence of multidrug-resistant (MDR) Klebsiella pneumoniae in UTI patients. Ashefo et al. (2023) found that K. pneumoniae isolates were highly resistant to beta-lactam antibiotics and frequently carried extended-spectrum beta-lactamase (ESBL) genes, commonly associated with previous antibiotic exposure. Similarly, Ayeni et al. (2024) in Keffi reported that most isolates came from patients with recent antibiotic use and showed resistance to multiple drug classes, including cephalosporins, fluoroquinolones, and aminoglycosides. These findings underscore the impact of antibiotic overuse in driving resistance. The World Health Organization (WHO) has also identified antibiotic misuse - especially common in low- and middle-income countries like Nigeria, where antibiotics are often obtained without prescriptions—as a major contributor to antimicrobial resistance. Studies, including Nwobodo et al. (2025), highlight the urgent need for improved antimicrobial stewardship across Nigerian healthcare settings.
Pregnant women were found to have a higher rate of Klebsiella pneumoniae infections compared to non-pregnant individuals. This increased susceptibility is likely due to reduced immune function during pregnancy, along with a combination of immunological, physiological, and hormonal changes (Samuel et al., 2016; Bishop and Shehu, 2016). Anatomical factors, such as the shorter female urethra and the potential for fecal contamination from improper hygiene, further elevate the risk of UTIs in women. During pregnancy, additional factors - such as haemodilution, urinary stasis, decreased urine concentration, and glycosuria - create a favorable environment for bacterial colonization in the urinary tract (Smaill and Vazquez, 2023; Almehda et al., 2017).
Conclusion
The prevalence of K. pneumoniae in the Urine of patients attending Federal Teaching Hospital Katsina, Nigeria was 5.5%, A socio-demographic factor that was significantly associated with urinary Klebsiella pneumoniae infection among the patients was the female gender (P < 0.05). However, none of the risk factors considered in this study were significantly associated with the prevalence of K. pneumoniae infection among the study population
Abdulfatai, K., Sanusi, S. B., Usman, A., Lawal, S. M., & Idris, M. (2023). Prevalence of antimicrobial susceptibility pattern of Klebsiella pneumoniae and Pseudomonas aeruginosa among women attending antenatal care in Kaduna Nigeria. Science World Journal, 18, 114–119.
Adeyemi, A. O., Oladipo, E. K., & Musa, A. Y. (2021). Bacteriological analysis and antibiotic susceptibility pattern of urinary tract pathogens among patients in a tertiary hospital. African Journal of Clinical and Experimental Microbiology, 22(2), 149–156.
Ajobiewe, J. O., Yabwa, K. G., Ajobiewe, H. F., Ogundeji, A. A., & Umeji, L. C. (2020). Prevalence of Klebsiella pneumoniae infection in adults attending National Hospital Abuja, Nigeria. Scholars Journal of Applied Medical Sciences, 8(7), 1667–1672. [Crossref]
Akoachere, J. F., Yvonne, S., Akum, N. H., & Seraphine, E. N. (2012). Etiologic profile and antimicrobial susceptibility of community-acquired urinary tract infection in two Cameroonian towns. BMC Research Notes, 5(1), 1–8. [Crossref]
Aliyu, M. S., Sadiq, M. N., & Salihu, L. (2017). Prevalence and antibiogram of uropathogens isolated from catheterized patients in Jos University Teaching Hospital, Nigeria. Sahel Medical Journal, 20(1), 23–28.
Almehdawi, K. A., Ali, R. H., & Ismail, F. F. (2017). Bacteriuria in pregnant and non-pregnant women in Benghazi: A comparative study. Journal of Pharmacy and Biological Sciences, 12, 133–137. [Crossref]
Amani, J., Tayebeh, F., Nazarians, S., Moradyr, M., & Mirhossein, S. A. (2016). Molecular diagnosis of clinically isolated strains by PCR. Journal of Applied Biotechnology Reports, 3(4), 501–505.
Aneke, C. C., Onyemelukwe, N. F., Chukwueze, C. M., Enebe, J. T., Jideofor, L., & Nwobodo, Aplastic Anemia Taskforce. (2017). American Journal of Haematology, 92(6), 560–576.
Ashefo, D. P., Ngwai, Y. B., Ishaleku, D., Nkene, I. H., Abimiku, R. H., & Tama, S. C. (2023). Detection of antimicrobial susceptibility pattern and molecular detection of resistance genes in Klebsiella pneumoniae isolated from urine samples of suspected UTI patients attending public hospitals in Nasarawa State, Nigeria. South Asian Journal of Research in Microbiology, 17(1), 15–26. [Crossref]
Ayeni, R., Olley, M., Ibrahim, I., & Ashe, A. C. (2024). Prevalence and antibiotic susceptibility profile of uropathogenic ESBL-producing Klebsiella pneumoniae in Keffi Metropolis, Nigeria. Asian Journal of Research in Infectious Diseases, 15(12), 1–15. [Crossref]
Beyene, D., Bitew, A., Fantew, S., Mihret, A., & Evans, M. (2023). Multidrug-resistant profile and prevalence of extended-spectrum beta-lactamase and carbapenemase production in Klebsiella pneumoniae isolated from urinary tract infections in Africa: A systematic review and meta-analysis. Antimicrobial Resistance and Infection Control, 12(1), 4.
Bindu, C. K., & Krishnaiah, N. (2010). Detection of Escherichia coli O157:H7 in foods of animal origin by cultural methods and PCR technique. Veterinary World, 3(1), 13–16. [Crossref]
Bishop, H. G., & Shehu, F. (2016). Prevalence and antibiotic susceptibility patterns of bacterial etiologies of urinary tract infections among students attending Sick-Bay of Ahmadu Bello University, Nigeria. Edorium Journal of Microbiology, 2, 7–12.
Bolton, D. J., Robertson, L. J., Osborne, M. P., Webb, J., & McDowell, D. A. (2019). The role of host immune responses in controlling Klebsiella pneumoniae infection and the potential for immunotherapy. Frontiers in Immunology, 10, 2407.
Brown, A. E., & Smith, H. (2023). Benson's microbiological applications: Laboratory manual in general microbiology (15th ed.). McGraw-Hill.
Chang-Phone, F., Yi-Tsung, L., Jung-Chung, L., Te-Li, C., Kuo-Ming, Y., Feng-Yee, C., Han-Chan, C., Hau-Shin, W., Chih-Peng, T. V., & Kristopher, L. (2012). Klebsiella pneumoniae in gastrointestinal tract and pyogenic liver abscess. Emerging Infectious Diseases, 18(8), 1322–1325. [Crossref]
Ezebialu, C. U., Nwofor, M., Anyamene, C. O., & Obieze, N. R. (2024). Prevalence and risk factors of uropathogens in diabetic and non-diabetic patients attending a university medical centre in Awka, Anambra State. International Journal of Research and Innovation in Applied Science, 9(8).
Hamza, S., & Abdulhadi, S. K. (2016). The prevalence of Klebsiella species causing urinary tract infections.
Iregbu, K. C., Nwajiobi-Princewill, P. I., & Orogade, A. A. (2013). Urinary tract infections in a tertiary hospital in Nigeria: A five-year review. South African Journal of Infectious Diseases, 28(2), 66–70.
Katsina State Government. (2021). Administrative profile of Katsina North Senatorial District. katsinastate.gov.ng
Khan, A., Khan, M. I., & Azam, S. (2023). Comparative evaluation of rapid DNA extraction methods for Gram-negative bacteria in resource-limited settings. Journal of Microbiological Methods, 204, 106642.
Loveth, M. O., Yakubu, B. N., & Jediel, T. (2023). Molecular detection of carbapenemase resistance in Klebsiella pneumoniae isolated from urine of patients assessing General Hospital Keffi, Nasarawa state, Nigeria. AROC in Pharmaceutical and Biotechnology, 3(1), 01–07. [Crossref]
MacWilliams, M. P. (2015). Citrate Test Protocol. microbelibrary.org
Magdeldin, S. (2012). Gel Electrophoresis-Principles and Basics. IntechOpen, 1–15. [Crossref]
Mancuso, G., Midiri, A., Gerace, E., Marra, M., Zummo, S., & Biondo, C. (2023). Urinary tract infections: The current scenario and future prospects. Pathogens (Basel, Switzerland), 12(4), 623. [Crossref]
Martin, R. M., & Michael, A. B. (2018). Colonization, infection and the accessory genome of K. pneumoniae. Frontiers in Cellular and Infection Microbiology, 8, 4. [Crossref]
Martins, W. M. B. S., Narciso, A. C., Cayo, R., Santos, S. V., Fehlberg, L. C. C., Ramos, P. L., da Silva, A. M. M., & Gales, A. C. (2023). Klebsiella pneumoniae: A leading pathogen with multifaceted antibiotic resistance. Frontiers in Microbiology, 14, 1156862.
Munoz-Price, L. S., Poirel, L., & Bonomo, R. A. (2013). Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. The Lancet Infectious Diseases, 13(9), 785–796. [Crossref]
National Bureau of Statistics (NBS). (2023). Annual abstract of statistics: Population estimates. nigerianstat.gov.ng
National Population Commission (NPC). (2019). Demographic and health survey of Nigeria. population.gov.ng
Nwobodo, D. C., Ugwu, M. C., & Anie, C. O. (2025). Antimicrobial resistance and virulence in Klebsiella pneumoniae: A four-month study in Osogbo, Nigeria. Antimicrobial Stewardship & Healthcare Epidemiology, 5(1), 64. [Crossref]
Ogbukagu, C. M., Ekwealor, I. J., & Ezeobi, I. (2016). Antibiotic resistance profile of Klebsiella pneumoniae isolated from various clinical specimens in a tertiary hospital in Anambra State, Nigeria. Journal of Advances in Microbiology, 3(3), 1–8.
Okwume, C. C., Onyemelukwe, N. F., Abdullahi, I. N., Okoyeocha, O. E., & Asamota, S. D. (2021). Prevalence of symptomatic urinary tract infection and bacterial spectrum of diabetic and non-diabetic patients at the two teaching hospitals in Enugu, Nigeria. African Journal of Clinical and Experimental Microbiology, 22(4), 480–488. [Crossref]
Oladeinde, B. H., Omoregie, R., Olley, M., & Anunibe, J. A. (2011). Urinary tract infection in a rural community of Nigeria. North American Journal of Medical Sciences, 3(2), 75. [Crossref]
Oluwasemowo, O. O., Olaposi, O. V., Ojo, O. O., & Iwalokun, B. A. (2023). Antimicrobial resistance patterns of Gram-negative uropathogens isolated from catheter-associated urinary tract infections in Lagos, Nigeria. Journal of Global Antimicrobial Resistance, 32, 102–109.
Onuoha, S. C., & Fatokun, K. (2014). Bacterial isolates from urinary tract infections in Port Harcourt, Nigeria. International Journal of Current Microbiology and Applied Sciences, 3(7), 81–90.
Pitout, J. D., Nordmann, P., & Poirel, L. (2015). Carbapenemase-producing K. pneumoniae, a key pathogen set for global nosocomial dominance. Antimicrobial Agents and Chemotherapy, 59, 5873–5884. [Crossref]
Poirier, A. C., Kuang, D., Siedler, B. S., Borah, K., Mehat, J. W., Liu, J., Tai, C., Wang, X., van Vliet, A. H. M., Ma, W., Jenkins, D. R., Clark, J., LaRagione, R. M., Qu, J., & McFadden, J. (2022). Development of Loop-Mediated Isothermal Amplification Rapid Diagnostic Assays for the Detection of Klebsiella pneumoniae and Carbapenemase Genes in Clinical Samples. Frontiers in Molecular Biosciences, 8(794961), 1–15. [Crossref]
Ragas, B., Yilma, D., Sewunet, T., & Beyene, G. (2015). Antimicrobial susceptibility pattern of bacterial isolates from community-acquired pneumonia patients in Jimma University Specialized Hospital, Jimma, Ethiopia. Saudi Journal of Health Sciences, 4, 59–64. [Crossref]
Russo, T. A., & Marr, C. M. (2019). Hypervirulent Klebsiella pneumoniae. Clinical Microbiology Reviews, 32(3), 1–19. [Crossref]
Russo, T. A., Marr, C. M., & Olsen, J. C. (2023). The rise of nosocomial Klebsiella pneumoniae: Epidemiology, outbreaks, and antimicrobial resistance in healthcare settings. The Lancet Infectious Diseases, 23(5), 172–183.
Samuel, O., Victoria, O., & Ifeanyi, O. (2016). Prevalence of asymptomatic bacteriuria among the pregnant women receiving antenatal care at Federal Medical Centre Owerri, Nigeria. Universal Journal of Clinical Medicine, 4, 1–5. [Crossref]
Smaill, F. M., & Vazquez, J. C. (2023). Antibiotics for asymptomatic bacteriuria in pregnancy: Impact of hemodilution and urinary stasis. Cochrane Database of Systematic Reviews, 3(5), CD000490.
Tian, X., Zhang, Y., Wang, Q., Chen, Y., & Han, L. (2024). Fecal-oral transmission dynamics of carbapenem-resistant Klebsiella pneumoniae in hospital settings. The Lancet Microbe, 5(3), 178–189.
Trecarichi, E. M., Quirino, A., Scaglione, V., Longhini, F., Garofalo, E., Bruni, A., & Torti, C. (2022). Klebsiella pneumoniae infections in hospitalized patients with urinary tract-related conditions: Antimicrobial resistance trends and emerging pathogen characteristics. Journal of Global Antimicrobial Resistance, 28, 12–19.
Wright, M. H., Sirdaarta, J., White, A., Greene, A. C., & Cock, I. E. (2017). GC-MS headspace analysis of Terminalia ferdinandiana fruit and leaf extracts which inhibit Bacillus anthracis growth. Journal of Pharmacognosy, 9(1), 73–82. [Crossref]
Wyres, K. L., Lam, M. M. C., & Holt, K. E. (2024). Population genomics of Klebsiella pneumoniae. Nature Reviews Microbiology, 22(1), 32–49.
Yusuf, Y., Abdulmalik, B. S., Aliyu, M. I., Ummukulthum, L. H., & Reymond, J. N. (2018). Risk of Shiga Toxigenic E. coli O157:H7 infections from raw and fermented milk in Sokoto Metropolis, Nigeria. Journal of Infectious Diseases, 45(1), 556–559. [Crossref]