UMYU Journal of Microbiology Research

E-ISSN: 2814 – 1822; P-ISSN: 2616 – 0668

ORIGINAL RESEARCH ARTICLE

Gut Microbiome Composition and GC-MS Analysis of the Oil Extract from Termite species in Uyo, Akwa Ibom State, Nigeria.

^{* 1}Akpan, A.U. ,., ²Johnny^, I. I. , ¹Chikezie, F. M. , ³Ekedo, C. M. , ¹Ubulom, P. M. E. , ¹Esenowo, I. K. , ¹Oboho, D. E. , Ukatu, P. O., ¹Ekpo, E. J. and ¹Essien, U. B

¹Department of Animal and Environmental Biology, Faculty of Biological Sciences, University of Uyo. Uyo. Akwa Ibom State. Nigeria.

²Department of Pharmacognosy and Natural Medicine, Faculty of Pharmacy, University of Uyo.

Akwa Ibom State. Nigeria.

³Department of Zoology and Environmental Biology, Michael Okpara University of Agriculture, Umudike, Abia state. Nigeria.

*Corresponding Author: akpanau13001f@gmail.com

Abstract

Termites are eusocial insects of the order Isopter, with members gut harbouring certain bacteria and fungi. This study analysed the micro-organisms in the gut of termite species. Ten (10) termitaria were excavated, and termites collected were identified into two species Macrotermes sp. and Odontotermes sp. Fifteen (15) Workers, 25 mandibulated soldiers, and one (1) Queen for Macrotermes sp., and fifteen (15) workers, 25 soldiers, and one Queen for Odontotermes sp were subjected to isolation and characterization of micro-organisms' symbionts from their gut using microbial techniques, grams staining, biochemical, and molecular techniques. The microbial communities harboured in the termites’ gut of the workers, soldiers, queen, and king castes of the Macrotermes sp. and Odontotermes sp. were identified as bacteria of the genera Bacillus sp., Salmonella sp., Shigella sp. and Escherichia coli, and fungi of the genera, Fusarium sp, Termitomyces sp, and Chaetomium sp. The GC-MS analysis of the oil extract from the termite queen demonstrated the presence of thirty-one (31) chemical components. The most prevailing constituents were thymol (23.31 %), seconded by gamma-Terpenene (17.31 %), and followed by p-Cymene (16.40 %), Phenol-2-methyl-5-(1-methyl ethyl)- (7.19%), Lupeol (5.94 %), Terpinen-4-ol (3.19), and Caryophyllene oxide (2.47 %). The results indicated that the termite species host diverse groups of symbiotic bacteria carrying out different enzymatic functions in the gut. This work was the first to report the GC-MS component of the oil extract from termite queen in south-south Nigeria. Nevertheless, further study on the interaction of microbiomes in the gut of termite species is recommended.

Keywords: Macrotermes sp, Odontotermes sp, Bacillus sp, Salmonella sp, Shigella sp.

INTRODUCTION

Termites are eusocial insects and members of the order Isoptera (Auer et al., 2017; Akpan et al., 2020; Akpan et al., 2022). Several castes, including reproductive (Queen) and non-reproductive (worker and soldier), make up the termitarium (Devaraji and Kesti, 2019).
In tropical and subtropical regions, termites are the most common invertebrate decomposers of decomposing organic matter (Brune, 2014). The combination of a sophisticated social structure and a unique ability to absorb plant materials, especially wood, is often credited with their ecological success (Akpan et al., 2020; Akpan et al., 2022). Subterranean, dry-wood, and damp-wood termites are the three main categories of termites according to their environment (Tai et al., 2015; Auer et al., 2017). Globally distributed, termites are effective wood-degrading insects that play a critical role in the environment's carbon cycle and may serve as sources of biochemical catalysts (Brune, 2014, Scharf, 2015). In order to break down the lignocelluloses in their feeds, termites have evolved and modified to form symbiotic interactions with a variety of microorganisms in their intestines (Brune, 2014; Scharf, 2015). With a significant impact on soil's chemical and physical composition, plant deterioration, nitrogen and carbon cycles, and microbial activity, termites play an essential role in the ecosystems (Brune and Dietrich, 2015). Despite being important species in ecosystems because they recycle a lot of nutrients, termites are also pests that have a significant negative economic impact (Claybourne, 2013; Rossmasssler et al., 2015; Bourguignon et al., 2016; Devaraj and Kesti, 2019).
Termites eat a diet low in nitrogen sources, thus, the gut symbionts' ability to fix nitrogen is a crucial part of the termite symbiotic system. Additionally, the gut symbionts play a part in the breakdown of nitrogen waste products that are released, like uric acid, which is produced during termite metabolism (Ohkuma, 2003; Devaraj and Kesti, 2019).
The gut of termites, according to Schauer et al. (2012), Kohler et al. (2012), Lima et al. (2014), and Kumar et al. (2020), the midgut is a major site of microbial colonization due to the high concentration of small-chain fatty acids that are accessible there. Biotic and abiotic factors and the gut physico-chemical circumstances affect the activity and composition of termites' gut microbiota (Tokuda et al., 2014; Brune and Dietrich, 2015). According to Ali et al. (2019), termites are known to dissimilate a significant amount of cellulose (74–99%) and hemicellulose (65-87%) from the lignocellulose they consume. They are also crucial for the turnover and mineralization of complex biopolymers, including wood and other materials that contain cellulose and hemicellulose (Akpan et al., 2020).
Various termites' guts have yielded several cellulolytic bacterial strains (Ramin et al., 2008; Brune, 2014; Brune and Dietrich, 2015; Sharma et al., 2015). Termites consume a variety of foods, although their primary dietary source is cellulose (Sharma et al., 2015). Termites lack the enzymes necessary to break down cellulose and lignin, which provide them access to additional carbohydrates; thus, there is a need to investigate the guts of the termite species found at the University of Uyo in Akwa Ibom state, Nigeria. The analysis of GC-MS of the oil of termites is also the aim of this study.

MATERIALS AND METHODS 

Study area

The University of Uyo Main Campus in Uyo, Akwa Ibom State, served as the research site. The University's Main Campus is 1,443 hectares and is located along Nwaniba Road. It is situated in the southern part of the country, between latitudes 5.0408^oN and 7.9198^oE (The University of Uyo, 2016; Akpan et al., 2020).
Four (4) sampling sites were identified from the study area for the study. At the University of Uyo Main Campus, Nwaniba Road, Uyo, all of the sampling locations were situated next to the University of Uyo Water Factory and Mini Market. In these locations, termite mounds can grow up to 1.4 to 1.9 meters in height. Bushes having Elephant grass (Pennistrum purpureum), Lemon grass (Cymbopogon citratus), and Siam weed (Chromolaena odorata) bordered these areas.
Ten (10) termite mounds were excavated from the four sampling sites, and thirty (30) soldiers and workers termites were collected. After being stored in sterile plastic containers, the termite samples were taken to the Department of Animal and Environmental Laboratory to be identified using Constantino's (1999) identification guidelines.

Isolation of Microorganisms from the termite gut

According to Devaraj and Kesti's (2019) description, the termite samples were processed. Sterile water and 95% ethanol were used to surface sterilize them. Each termite group's gut was removed with forceps and scissors and then submerged in 0.7% sterile saline water. After vortexing the tube containing the intestines and one millilitre of 0.9% saline, it was let to stand for twenty minutes. The supernatant was used as a microbiological inoculum once the gut tissue had calmed down.
According to the manufacturer's instructions, several media were manufactured to analyze, isolate, and characterize bacteria and fungi from the termite species' guts. Using the supernatant as a microbial inoculum, the entire 100 and 50µl inoculum—which included 0.5g peptone, 0.3g beef extract, 0.5g NaCl, 1.5g agar, and 1g carboxymethylcellulose—was added to Nutrient Agar medium. For 24 to 48 hours, the Petri plates were incubated at 37°C (Devaraj and Kesti, 2019). Potato dextrose agar was incubated at room temperature for three to five days. A list of the newly formed colonies was made.
In contrast to Shigella and Salmonella agar, which were sterilized by boiling them, MacConkey, Nutrient, Eosin Methylene Blue, and Potato Dextrose agar were autoclaved at 121°C for 15 minutes at 15 pounds per square inch.

Identification and characterization of microbial species

According to Peekate (2022), morphological characteristics, Gram staining reactions for bacteria, and biochemical assays for both colonies were used to identify bacterial and fungal colonies. Bergey's Manual of Determinative Bacteriology was used to confirm the identification of the bacterial isolates (Buchanan and Gibbons, 1994).
Salmonella and Shigella agar were used to measure the total heterotrophic fungi count, while MacConkey agar was used to measure the total coliform count, Nutrient agar for the total heterotrophic bacterial count, Eosin Methylene blue agar for the faecal coliform count. The following biochemical techniques were used to identify the isolates:

Gram staining reaction:

The purpose of this test was to distinguish between gram-positive and gram-negative microorganisms.
On a spotless, grease-free slide, a loopful of water was put. After being moved from the petri dish to a slide free of grease, a loopful of the test organism was spread out. Heat-fixing was used on the smear. After applying crystal violet dye and letting it sit for 30 to 60 seconds, the heat-fixed smear was rinsed with water and flooded with Lugol's Iodine, which was likewise left for 30 to 60 seconds before being rinsed with water. After being further saturated with 70% alcohol and left for ten to fifteen seconds, the slide was cleaned with water. Finally, the slide was immersed in Safrarin and left for 30 to 60 seconds before being drained and allowed to air dry. An ×100 objective was used to view the slide under a microscope.

Biochemical Tests

Based on variations in the biochemical activity of the various bacteria isolates, biochemical tests were used to identify bacterial and fungi species, according to Peekate (2022). The different biochemical tests that were performed are listed as follows: the catalase test (Facklam and Elliott, 1995, Devaraj and Kesti, 2019), the Coagulase test (Holt et al., 1994), the Indole test (MacFaddin, 2000), Oxidase examination (Win et al. 2006, Vashist et al., 2013), the citrate test, the Urease Test (Bailey and Scott, 1974), the Voges-Proskauer (V-P) test (Bachoon et al. 2008), the methyl red test (Crown and Gen, 1998).

The spore test

This test aimed to ascertain whether microorganisms could create a resilient structure that would allow them to endure for an extended amount of time in an adverse environment or situation. Using a sterile wire loop, the test organism was smeared onto a sterile, grease-free slide. After heat-fixing the smear, the slide was submerged in boiling water. On the slide was a paper towel that had been soaked in a malachite green solution. After 5 to 6 minutes of gentle heating, the Malachite green solution started to steam and was refilled as it evaporated. The slide was left to cool after using forceps to remove the paper towelling. After 30 seconds of water rinsing, the slide was counter-stained with Safrarin and left for another 30 to 60 seconds. After being cleaned with water, the Safranin was allowed to air dry before being examined under a microscope. Under a microscope, vegetative cells showed a green stain, whereas endospores showed a dark green stain.

The motility test

The purpose of this test was to evaluate an organism's mobility. After being distributed into test tubes, the motility test medium was autoclave sterilised for 15 minutes at 15 pounds and 12°C. Test tubes containing the medium were left upright to cool.
The medium was stabbed three-quarters of the way to the tube's bottom with a sterile inoculating needle to introduce the test organism. After 14 to 40 hours, the infected medium was tested after being incubated at 37°C. The diffused zone of development extending from the line of inoculation was a sign of motility. Motile organisms were defined as those that spread out from the inoculation line.

Test for the fermentation of carbohydrates

This test aimed to demonstrate the isolates' capacity to use various carbohydrates. In sterile glass test tubes, 1% methyl red indicator was added to sterile peptone water before the necessary amount of sugar (sterilised by Seitz filtering) was added.
After the test organism was added to the mix, sterile inverted Durham's tubes were placed into the media. After 48 hours of incubation at 37°C, they were checked for the generation of gas or acid. While the presence of air bubbles in Durham's tubes indicated gas production, a colour shift from red to yellow suggested acid production and a favourable outcome.

Identification of Fungi

The presence or absence of white and filamentous characteristics, foot cell vegetative structure, and conidiophore reproductive structure served as the basis for the fungi isolates' confirmatory tests.

Counting of Isolates

The medium (Eosin Methylene Blue agar (EMB), Nutrient Agar (NA), and Mannitol Salt Agar (MSA)) were inoculated in triplicate and incubated at 37 °C for 24 hours in order to count and isolate bacteria using the pour plate method. Pure cultures were obtained by counting, characterising, and subculturing distinct bacterial colonies. The isolates were counted in cfu/ml (Matthew et al., 2017).

Molecular analysis of Bacterial isolates using PCR and 16s r-RNA Sequence Analysis

The isolated cultures of the detected bacteria were prepared and sent for molecular identification. A single band of high-molecular-weight DNA was seen when the culture's DNA was separated and tested on a 1.2% Agarose gel. The Veriti® 96-well Thermal Cycler (Model No. 9902) was used to amplify the isolated DNA using the 16S rRNA universal primers 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) (Fuks et. al., 2018). There was only one distinct 1500 bp PCR amplicon band visible. After enzymatic purification, the PCR amplicon underwent Sanger sequencing. 704F and 907R primers were used in a bi-directional DNA sequencing reaction of the PCR amplicon using the BDT v3.1 Cycle sequencing kit on an ABI 3730xl Genetic Analyser. Using aligner software, forward and reverse sequence data produced a consensus sequence of 1500 bp for the cultures' 16S rDNA. The Basic Local Alignment Search Tool (BLAST) from the NCBI website was utilized to do a BLAST alignment search on the 16S rDNA sequence of the National Centre for Biotechnology Information (NCBI) database. (Devaraj and Kesti, 2019; Ali et al., 2019; Amadi et al., 2024).

GC-MS analysis of the oil extract from termites

The oil used in the GC-MS was taken from the Odontotermes sp. termite queen. The components were separated using helium as a carrier gas at a steady flow rate of 1 millilitre per minute, and the GC-MS utilized in the research had a fused silica column loaded with Elite-1. Two microlitres of the termite queen's oil were employed for GC-MS analysis (Hervé et al., 2020). After being injected into the device, the sample extracts were found. The oven was kept at 290 °C for two minutes during the twenty-third minute of the GC extraction procedure. With pieces ranging from 40 to 440 Da and a scanning interval of 0.5 s, mass spectra were acquired at 70 eV. The relative percentage amount of each component was determined by comparing each component's average peak area to the total areas (Hema et al., 2010).

GC-MS identification from the termite queen oil's

The National Institute of Standards and Technology (NIST) database, which contains over 62,000 patterns, was used to interpret mass-spectrum GC-MS. The NIST library's collection of known components was compared to the spectrum of the unknown components. The test materials' percentage area, molecular weight, compound name, and retention duration were determined (Hema et al., 2010).

RESULTS

This study identified two termite species; Odontotermes sp and Macrotermes sp. Microorganisms isolated from the Odontotermes sp. and Macrotermes sp. were fungi and bacteria. Bacillus, Salmonella, Escherichia, and Shigella were the bacteria that were identified and described from Odontotermes sp (Table 1). According to the findings presented in Table 2, Bacillus sp. Termitomyces sp. and Chaetomium sp. were the bacterial and fungal isolates separated from the gut of Macrotermes sp.

Table 1: Microorganisms isolated and characterised from Odontotermes sp.

Table 2: Microbiomes isolated and characterized from the gut of Macrotermes sp.

Morphological and biochemical characterization of the Bacterial isolates

As seen in Table 3, most of the isolates were rod-shaped gram-negative bacteria. The majority of the isolates had negative reactions to the tests for urease, citrate, oxidase, spore, indole, and coagulase (Table 3). 

Table 3: Morphological, biochemical characterisation of the Bacterial isolates

R = Rod

+ = Positive

- = Negative

A = Acid

AG = Acid and Gas

SB = Suspected Bacteria

Mean count of organisms isolated from Odontotermessp.and Macrotermessp

The total bacteria count in Odontotermes sp gut was 85 cfu/ml, and the highest bacteria count 76 cfu/ml, was in the Old worker (Od./Ma.) gut. The results for the mean count of the other isolated microbiomes from the gut of the termite species are presented in Table 4.

Table 4: Total Mean Count of Isolates from Odontotermes sp.and Macrotermes sp gut

Keywords: TMHBC = Total Mean Heterotrophic Bacterial Count, TMCC = Total Mean Coliform Count, TMFCC = Total Mean Fecal Coliform Count, TMSSC = Total Mean Salmonella and Shigella Count, TMHFC = Total Mean Heterotrophic Fungal Count. Od. = Odontotermes sp, Ma. = Macrotermes sp

Blast analysis of 16SrRNA of Bacterial Isolates

The Blast data analysis results revealed 99% identification similarity to the bacterial isolates: Bacillus sp, Shigella sp, Escherichia coli, and Salmonella sp. (Table 5).

Table 5: Blast analysis of 16SrRNA of the bacterial and fungal isolates from the two termite species gut used in this study

GC-MS analysis of the Termite Queen Oil

Thirty-one (31) significant chemical constituents were found in the Termite queen oil (Odontotermes sp.), according to the results of the GC-MS study (Table 6). Thymol (23.31 percent), gamma-terpenene (17.31 percent), p-cymene (16.40 percent), phenol-2-methyl-5-(1-methyl ethyl)- (7.19%), luteol (5.94 percent), terpinen-4-ol (3.19 percent), and caryophyllene oxide (2.47 percent) were the most prevalent constituents (Table 6).

Table 6: Chemical composition of the Termite Queen Oil by GC-MS analysis

Figure 1: Structures of some abundant chemical constituents in the GC-MS

Analysis of the termite Queen Oil.

DISCUSSION

The results of the gut analysis of the termite species, Odontotermes sp, and Macrotermes sp, identified in this study, have revealed that bacteria Bacillus sp, Salmonella sp, Shigella sp., Escherichia coli, and fungi; Fusarium sp, Termitomyces sp, and Chaetomium sp, inhabit their guts.. According to Kumar et al. (2020), the termite species rely mostly on the bacterial and fungi communities to break down the cellulose-based dietary items. Majeed et al. (2012), Brune and Dietrich (2015), and Tai et al. (2015) reported that the eating habitat and habits of the termite species influenced the richness of the microorganism community. In line with Costa et al. (2019) and Kumar et al. (2020), who discovered that Odontotermes sp gut harboured both aerobic (Bacillus) and anaerobic (Escherichia coli) bacteria, the previous worker of Odontotermes sp stomach harboured Salmonella sp, Shigella sp, Bacillus sp, and Escherichia coli. Although Costa et al. (2019) stated that the gut of Macrotermetes sp may only harbour coccoid lactic acid bacteria, every group of Macrotermetes sp in this study harboured exclusively aerobic bacteria, specifically Bacillus sp. The results on the bacterial isolates iedentified in the termite species revealed that all the categories of the two termite species, except for soldier s of Odontotermes sp have Bacillus sp. in their guts, which according to Zhou et al. (2018) and Adebajo et al. (2021) they are involved in the breaking down of lignocelluloses and it preserves the gut environment The predominant of Bacillus sp in Odontotermes sp and Macrotermes sp agreed with Wenzel et al., (2002) are also involved in biphenyl degradation in termite gut (Bugg et al., 2010) nd there is a possibility that the microorganisms identified in this study increase the nitrogen supply by recycling termite uric acid wastes (Brune, 2006; König, 2006). However, because of their relative abundance in the termite gut system and being isolated from termite gut, Bacillus sp by their function in the degradation of lignocellulose, may be regarded as mutualists (Matthew et al., 2012).

Fungal species from the Agaricomycetes and Sordariomycetes families exhibit symbiotic interactions in the stomachs of all termite species (Brune, 2014; Auer et al., 2017). The most common fungus species found in all the termite groupings in this study was Termitomyces sp. This result was consistent with Zhou et al. (2018), who found that Termitomyces sp. is the predominant fungus in the gut of termite species. Termites' guts include a variety of fungi that aid in the digestion of cellulose, hemicelluloses, lignin, and lactase (Kumar et al., 2020).

The results of the microorganisms isolated from the gut of the two termite species in this study comparatively revealed that the old workers of the colony of Odontotermes sp habour; Bacillus, Salmonella sp, Shigella sp., and Echerichia coli as bacterial isolates and Fuscarium sp, Termitomyces sp and Chaetomium sp, while other termite categories in the Odontotermes and Macrotermes colonies haboured only Bacillus sp for bacterial group and Termitomyces for fungal group. The old workers within the colony are primarily responsible for forging for food and they take over food acquisition role (Gordon, 2016). The presence of the classes of the species of the bacterial and fungi isolates in the gut of the old workers may further lead to an increase in per-capita food consumption of the termite colony because the isolated microorganisms enhance the old workers to take-in more cellulose materials for the growth of the colony. The young and old workers continuously bring in partly degraded plant materials substrates to their colony, and these substrates are fed upon by other categories in the colony (Um et al., 2013).

Gas chromatography-mass spectrometry has recently been used as a very successful technique for identifying the chemical elements found in both plant and animal extract (Balamurugan et al., 2012). Gamma-terpinene one of the chemicals found in the termite queen oil may have analgesic, anti-inflammatory, antioxidant, and antibacterial properties (Devi and Muthu, 2015). Terpinen-4-ol has been used as a flavouring agent, having anti-inflammatory and anti-cancer properties (Sarkar and Sawardekar, 2022). The terpinenes reported from the GC-MS extraction of the oil of the termite queen are three isomeric hydrocarbons that are classified as terpenes. Gamma-terpinene as one reported in this study, is natural and has been reported by several other researchers Forti and Ingold (2003) and Hamdan et al. (2013), is also isolated from a variety of plant and animal sources. It is a major component of essential oils made from Citrus Fruits and has strong antioxidant activity. It has a lemon odour and widely used in food, flavours, soaps, cosmetics, pharmaceutical, tabacco, confectionery and perfume industries (Hamdan et al., 2013). Nevertheless, the essential oils reported from the GC-MS results of the termite queen oil strongly indicate that the essential oil from termite could serve several important health benefits to humans.

CONCLUSION

Termites’ gut is a repository for diverse microorganism community composition. This study has firmly demonstrated that Odontotermes sp, and Macrotermes sp detected in University of Uyo harbour bacteria; Bacillus sp, Salmonella sp, Shigella sp., Escherichia coli, and fungi; Fusarium sp, Termitomyces sp, and Chaetomium sp. that are of major value to the food function of the termite species. The GC-MS of the oil of the queen of the termite species demonstrated how rich the oil of the queen of termite is, composed of various chemical elements that are of great helpful to man. Further study is proposed on the GC-MS of the oil of the termite queen. It is strongly advised that more investigations which could lead to the uncovering of novel species of microbiomes beyond bacteria and fungal groups, should be done on the gut of termites.

Conflict of interest

None.

REFERENCES

Adebajo, S. O., Akintokun, P. O., Ezaka, E., Ojo, A. E., Olannye, D. U., & Ayodeji, O. D. (2021). Use of termitarium soil as a viable source for biofertilizer and biocontrol. Bulletin of the National Research Centre, 45, 1–8. [Crossref]

Akpan, A. U., Ojianwuna, C. C., Ubulom, P. M. E., Yaro, C. A., & Oboho, D. E. (2020). Effect of physico-chemical parameters on the abundance and diversity of termites and other arthropods in termite mounds in Uyo, Akwa Ibom state, Nigeria. FUDMA Journal of Sciences (FJS), 4(2), 92–100. [Crossref]

Akpan, A. U., Ehisianya, C. N., Ukpai, O. M., Johnny, I. I., Oboho, D. E., Sam, M. E., & Usanga, E. E. (2022). Efficacy of the methanolic and aqueous extracts of Carica papaya and Azadirachta indica against wood termite (Odontotermes badius) in Uyo, Akwa Ibom State, Nigeria. Nigerian Journal of Environmental Sciences and Technology (NIJEST), 6(1), 28–37. [Crossref]

Ali, H. R. K., Hemeda, N. F., & Abdelaliem, Y. F. (2019). Symbiotic cellulolytic bacteria from the gut of the subterranean termite Psammotermes hypostoma Desneux and their role in cellulose digestion. AMB Express, 9(1), 111. [Crossref]

Amadi, N. K., Peekate, L. P., & Wemedo, S. A. (2024). Physicochemical and bacteriological characteristics of groundwater in Rumuigbo, Obio-Akpor Local Government Area of Rivers State, Nigeria. UJMR, 9(1), 46–54. [Crossref]

Auer, L., Lazuka, A., Sillam-Dussès, D., Miambi, E., O'Donohue, M., & Hernandez-Raquet, G. (2017). Uncovering the potential of termite gut microbiome for lignocellulose bioconversion in anaerobic batch bioreactors. Frontiers in Microbiology, 8, 2623. [Crossref]

Bachoon, D., Wendy, S., & Dustman, A. (2008). Microbiology laboratory manual (M. Stranz, Ed.). Cengage Learning.

Bailey, W. R., & Scott, E. G. (1974). Diagnostic microbiology (4th ed.). Mosby.

Balamurugan, K., Martin, L., Tracey, U. H., George, C. M., & George, T. D. (2012). Mutation at the human D1S80 minisatellite locus. The Scientific World Journal, 2012, Article ID 917235. [Crossref]

Bourguignon, T., Sobotník, J., Dahlsjö, C. A. L., & Roisin, Y. (2016). The soldierless Apicotermitinae: Insights into a poorly known and ecologically dominant tropical taxon. Insectes Sociaux, 63, 39–50. [Crossref]

Brune, A. (2006). Symbiotic associations between termites and prokaryotes. In M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, & E. Stackebrandt (Eds.), The prokaryotes: A handbook on the biology of bacteria: Symbiotic associations, biotechnology, applied microbiology (Vol. 1, pp. 439–474). Springer-Verlag. [Crossref]

Brune, A. (2014). Symbiotic digestion of lignocellulose in termite guts. Nature Reviews Microbiology, 12(3), 168. [Crossref]

Brune, A., & Dietrich, C. (2015). The gut microbiota of termites: Digesting the diversity in the light of ecology and evolution. Annual Review of Microbiology, 69, 145–166. [Crossref]

Bugg, T. D. H., Ahmad, M., Hardiman, E. M., & Singh, R. (2010). The emerging role for bacteria in lignin degradation and bioproduct formation. Current Opinion in Biotechnology, 22(1), 1–7. [Crossref]

Buchanan, R. E., & Gibbons, N. E. (1994). Bergey's manual of determinative bacteriology (9th ed.). Williams & Wilkins.

Claybourne, A. (2013). A colony of ants, and other insect groups. Heinemann Library.

Constantino, R. (1999). An illustration key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers. Insect Systematics and Evolution, 31, 463–472. [Crossref]

Costa, R. R. D., Hu, H., Li, H., & Poulsen, M. (2019). Symbiotic plant biomass decomposition in fungus-growing termites. Insects, 10(4), 87. [Crossref]

Crown, S. T., & Gen, J. (1998). Micromethod for the methyl red test. Microbiology, 9(1), 101–109. [Crossref]

Devaraj, V., & Kesti, S. S. (2019). Isolation and molecular characterization of termite gut microflora. International Journal of Scientific Research in Biological Sciences, 6(3), 41–49. [Crossref]

Devi, I. A., & Muthu, A. K. (2015). Gas chromatography-mass spectrometry analysis of phytocomponents in the ethanolic extract from whole plant of Lactuca runcinata DC. Asian Journal of Pharmaceutical and Clinical Research, 8(1), 202–206.

Facklam, R., & Elliott, J. A. (1995). Identification, classification, and clinical relevance of catalase-negative, gram-positive cocci, excluding the streptococci and enterococci. Clinical Microbiology Reviews, 8(4), 479. [Crossref]

Foti, M. C., & Ingold, K. U. (2003). Mechanism of inhibition of lipid peroxidation by gamma-terpinene, an unusual and potentially useful hydrocarbon antioxidant. Journal of Agricultural and Food Chemistry, 51, 2758–2765. [Crossref]

Fuks, G., Elgart, M., Amir, A., Zeisel, A., Turnbaugh, P. J., Soen, Y., & Shental, N. (2018). Combining 16S rRNA gene variable regions enables high-resolution microbial community profiling. Microbiome, 6, 17. [Crossref]

Gordon, D. M. (2016). From division of labor to the collective behaviour of social insects. Behavioral Ecology and Sociobiology, 70, 1101–1108. [Crossref]

Hamdan, D., Ashour, M. L., Mulyaningsih, S., El-Shazly, A., & Wink, M. (2013). Chemical composition of the essential oils of variegated pink-fleshed lemon (Citrus × limon L. Burm. f.) and their anti-inflammatory and antimicrobial activities. Zeitschrift für Naturforschung C, 68, 275–284. [Crossref]

Hema, R., Kumaravel, S., & Sivasubramanian, C. (2010). GC-MS study on the potentials of Syzygium aromaticum. Researcher, 2, 1–4.

Hervé, V., Liu, P., Dietrich, C., Sillam-Dussès, D., Stiblik, P., Šobotník, J., & Brune, A. (2020). Phylogenomic analysis of 589 metagenome-assembled genomes encompassing all major prokaryotic lineages from the gut of higher termites. PeerJ, 8, e8614. [Crossref]

Holt, J. G., Krieg, N. R., & Sneath, P. H. A. (1994). Bergey's manual of determinative bacteriology (9th ed.). Williams & Wilkins.

Kohler, T., Dietrich, C., Scheffrahn, R. H., & Brune, A. (2012). High-resolution analysis of gut environment and bacterial microbiota reveals functional compartmentation of the gut in wood-feeding higher termites (Nasutitermes spp.). Applied and Environmental Microbiology, 78(13), 4691–4701. [Crossref]

König, H. (2006). Bacillus species in the intestine of termites and other soil invertebrates. Journal of Applied Microbiology, 101, 620–627. [Crossref]

Kumar, A., Asha, P., Sharma, R., Monika, J., Rakesh, S., & Rekha, S. (2020). Termite gut: Home to microbiome. Uttar Pradesh Journal of Zoology, 41(22), 9–23.

Lima, T. de, Pontual, E. V., Dornelles, L. P., Amorim, P. K., Sá, R. A., Coelho, L. C., Napoleão, T. H., & Paiva, P. M. (2014). Digestive enzymes from workers and soldiers of termite Nasutitermes corniger. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 176, 1–8. [Crossref]

MacFaddin, J. F. (2000). Biochemical tests for identification of medical bacteria (3rd ed.). Lippincott Williams & Wilkins.

Majeed, M. Z., Miambi, E., Robert, A., Bernoux, M., & Brauman, A. (2012). Xylophagous termites: A potential sink of atmospheric nitrous oxide. European Journal of Soil Biology, 53, 121–125. [Crossref]

Mathew, G. M., Ju, Y., Lai, C., Mathew, D. C., & Huang, C. C. (2012). Microbial community analysis in the termite gut and fungus comb of Odontotermes formosanus: The implication of Bacillus as mutualists. FEMS Microbiology Ecology, 79(2), 504–517. [Crossref]

Matthew, O., Chiamaka, R., & Chidinma, O. (2017). Microbial analysis of poultry feeds produced in Songhai farms, Rivers State, Nigeria. Nigerian Journal of Microbiology and Experimentation, 4(2), 11–12. [Crossref]

Ohkuma, M. (2003). Termite symbiotic systems: Efficient bio-recycling of lignocellulose. Applied Microbiology and Biotechnology, 61, 1–9. [Crossref]

Peekate, L. P. (2022). Deciphering the identity of bacterial isolates through conventional means: A practical guide. Edese Printing & Publishing Company.

Ramin, M., Alimon, A. R., Abdullah, N., Panandam, J. M., & Sijam, K. (2008). Isolation and identification of three species of bacteria from the termite Coptotermes curvignathus (Holmgren) present in the vicinity of university. Research Journal of Microbiology, 3(4), 288–292. [Crossref]

Rossmassler, K., Dietrich, C., Thompson, C., Mikaelyan, A., Nonoh, J. O., Scheffrahn, R. H., Sillam-Dussès, D., & Brune, A. (2015). Metagenomic analysis of the microbiota in the highly compartmented hindguts of six wood- or soil-feeding higher termites. Microbiome, 3, 56. [Crossref]

Sarkar, U., & Sawardekar, S. S. (2022). GC-MS analysis of extracted essential oil of Piper betel L. IJRASET Journal for Research in Applied Science and Engineering Technology, 10(11), 912–915. [Crossref]

Scharf, M. E. (2015). Termites as targets and models for biotechnology. Annual Review of Entomology, 60, 77–102. [Crossref]

Schauer, C., Thompson, C. L., & Brune, A. (2012). The bacterial community in the gut of the cockroach Shelfordella lateralis reflects the close evolutionary relatedness of cockroaches and termites. Applied and Environmental Microbiology, 78(8), 2758–2767. [Crossref]

Sharma, D., Joshi, B., Bhatt, M. R., Joshi, J., Malla, R., Bhattarai, T., & Sreerama, L. (2015). Isolation of cellulolytic organisms from the gut contents of termites native to Nepal and their utility in saccharification and fermentation of lignocellulosic biomass. Journal of Biomass and Biofuel, 2, 11–20. [Crossref]

Tai, V., James, E. R., Nalepa, C. A., Scheffrahn, R. H., Perlman, S. J., & Keeling, P. J. (2015). The role of host phylogeny varies in shaping microbial diversity in the hindguts of lower termites. Applied and Environmental Microbiology, 81(3), 1059–1070. [Crossref]

The University of Uyo. (2016). Uniuyo.nucdb.edu.org. Archived from the original on February 2, 2016. Retrieved January 27, 2016.

Tokuda, G., Tsuboi, Y., Kihara, K., Saitou, S., Moriya, S., Lo, N., & Kikuchi, J. (2014). Metabolomic profiling of 13C-labelled cellulose digestion in a lower termite: Insights into gut symbiont function. Proceedings of the Royal Society B: Biological Sciences, 281, 20140990. [Crossref]

Um, S., Fraimout, A., Sapountzis, P., Oh, D.-C., & Poulsen, M. (2013). The fungus-growing termite Macrotermes natalensis harbors bacillaene-producing Bacillus sp. that inhibit potentially antagonistic fungi. Scientific Reports, 3, 3250. [Crossref]

Vashist, H., Sharma, D., & Gupta, A. (2013). A review on commonly used biochemical test for bacteria. Journal of Life Sciences, 1(1), 1–7.

Wenzel, M., Schönig, M., Berchtold, M., Kämpfer, P., & König, H. (2002). Aerobic and facultatively anaerobic cellulolytic bacteria from the gut of the termite Zootermopsis angusticollis. Journal of Applied Microbiology, 92, 32–40. [Crossref]

Winn, W., Allen, S., Janda, W., Koneman, E., Procop, G., Schreckenberger, P., & Woods, G. (2006). Color atlas and textbook of diagnostic microbiology (6th ed.). Lippincott Williams & Wilkins.

Zhang, Z., Schwartz, S., Wagner, L., & Miller, W. (2000). A greedy algorithm for aligning DNA sequences. Journal of Computational Biology, 7(1–2), 203–214. [Crossref]

Zhou, J., Duan, J., Gao, M., Wang, Y., Wang, X., & Zhao, K. (2018). Diversity, roles and biotechnological applications of symbiotic microorganisms in the gut of termite. Current Microbiology, 76, 755–761. [Crossref]